BBa_K316000 1 sRBS Pehs Reverse strand coding Enhanced LacI-hyperspank promoter 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z DNA synthesis by MWG eurofins. The sequence was codon optimized for expression in B.subtilis using mwg ??? eurofins www.eurofinsdna.com proprietary software. This part is a modified version of hyper-spank promoter for B.subtilis <bbpart>BBa_K143015</bbpart>. Hyper-spank promoter is repressed by transcriptional repressor LacI <bbpart>BBa_K143033</bbpart> and can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). Constitutive expression of LacI is required for repression. Promoter Design The position and sequence of LacI binding was designed using existing knowledge. The stochastic nature of transcriptional repressors usually leads to background transcription. In order to minimise background the binding sites and the distance between them have been optimised. Stronger binding The natural LacI operator has 3 binding sites, all of which have variations in the binding sequences. Perfectly symmetric binding sequence was shown to have10-fold higher binding compared to wild type sequences. The aattgtgagc gctcacaatt sequence has been shown to be optimal for LacI binding Muller 1996 Oehler 1994. Optimal distance Due to the tetrameric nature of LacI it can simulataneously bind to multiple regions in the genome. Binding at multple sites can produce much stronger repression (muller 1996) by increasing local LacI concentrations. Due to the helical nature of DNA the distance between the operator sites plays an important role in the strength of repression. Maximal repression at 70.5bp, second strongest at 92.5bp and third at 115.5bp false false _440_ 0 7480 9 It's complicated false Designed for minimal basal transcription by altering the LacI binding site sequence and distance between them. false IC 2010 Team annotation2100978 1 LacI binding range2100978 1 21 51 annotation2100979 1 LacI binding range2100979 1 111 140 annotation2097815 1 sRBS range2097815 1 1 12 annotation2097817 1 scar range2097817 1 13 20 BBa_K316000_sequence 1 ttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z