BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z