BBa_K316002 1 Bs dif dif excision site from B. subtilis 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z The dif sites were made by annealing synthestised oligoes. Dif sites are naturally found in B.subtilis and are used by this organism during genome replication. false false _440_ 0 7480 9 Not in stock false The dif site was made by oligos designed to make overhangs for EcoRI and SpeI ( and ) or XbaI and PstI ( and ) to be used in standard Biobrick or 3A cloning. false IC 2010 Team BBa_K316002_sequence 1 atctcctagaatatatattatgtaaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z