BBa_J33204 1 BBa_J33204 xylE reporter gene with rbs 2006-10-16T11:00:00Z 2015-08-31T04:08:46Z The template DNA was kindly supplied by Dr. Peter Williams of the University of Wales, Bangor. The primer design was based on Genbank sequence M64747 (GI:151718). The sequence reported here was confirmed by sequencing the Biobrick construct. Released HQ 2013 This part includes the xylE gene from the Pseudomonas putida TOL (naphthalene and xylene degradadative plasmid) pWW0. This gene encodes the enzyme catechol-2,3-dioxygenase (metapyrocatechase), which converts catechol to the bright yellow product 2-hydroxy-cis,cis-muconic semialdehyde. This is a useful reporter gene; colonies or broths expressing active XylE, in the presence of oxygen, will rapidly convert catechol, a cheap colourless substrate, to a bright yellow compound with an absorbance maximum around 377 nm. The part includes the native ribosome binding site, so simply needs to be added after a suitable promoter to act as a reporter. I have previously used this gene to generate whole cell biosensors for various heavy metals. Note that, unlike Xgal etc., catechol in solution is prone to spontaneous oxidation resulting in brown melanin-like polymeric products, so is not stable enough to incorporate into plates or growth media; it should be dripped onto colonies (I use 10 mM catechol in water for this) or added to liquid cultures at a final concentration of about 0.5 mM prior to assay. Note also that there is a SacI site at the very start of the part, when the prefix is included, so this can be used as a replacement vector to introduce PCR products with SacI-SpeI ends into pSB1A2 giving them full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. false false _63_ 0 837 63 In stock true Note that this sequence includes the native ribsomome binding site. Also, when the prefix is included, there is a SacI site at the start, which allows this part to be used as a vector for insertion of PCR products with SacI-SpeI ends into pSB1A2, replacing xylE, giving the full Biobrick prefixes and suffixes (but don't forget the G base before the SpeI site). This results in shorter non-complementary tails on PCR primers than using a full prefix or suffix. You can test for colonies that have lost xylE using catechol as described above. true Chris French annotation1903406 1 rbs range1903406 1 14 19 annotation1903407 1 cds range1903407 1 27 950 BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K316003 1 BBa_K316003 XylE - catechol 2,3-dioxygenase from P.putida with terminator 2010-10-21T11:00:00Z 2015-05-08T01:11:56Z XylE was obtained from the registry <bbpart>BBa_K118021</bbpart>, the terminator is <bbpart>BBa_B0014</bbpart> Released HQ 2013 Catechol or catechol 2,3-dioxygenases + O(2) is converted by a ring cleavage into 2-hydroxymuconate semialdehyde which is the toxic and bright yellow-coloured substrate. This is a key enzyme in many (soil) bacterial species used for the degradation of aromatic compounds. The enzyme used here itself originating from Pseudomonas putida is a homotetramer of C230 monomers. The tetramerization interactions position a ferrous ion critical for enzymatic activity. It has been deduced that intersubunit interaction is essential to produce a functioning enzyme after performing N and C terminal modifications on the monomer. Coming together the subunits generate an active site. The reaction itself takes place within seconds after the addition by Pasteur pipette or spraying of catechol at a 100mM stock solution diluted with DDH20 (used by our lab.) The toxic byproduct is thought to interfere with cell wall integrity and cellular machinery such that exposed cells gradually die. false false _440_ 0 7480 9 In stock true The parts were put together using standard assembly [http://partsregistry.org/Assembly:Standard_assembly] false IC 2010 Team component2092335 1 BBa_J33204 component2092342 1 BBa_B0014 annotation2092342 1 BBa_B0014 range2092342 1 967 1061 annotation2092335 1 BBa_J33204 range2092335 1 1 958 BBa_K316005 1 Pveg Xyle Functional XylE under Pveg promoter, with double terminator 2010-10-21T11:00:00Z 2015-05-08T01:11:56Z Biobrick parts <bbpart>BBa_J33204</bbpart> <bbpart>BBa_B0014</bbpart> Enables characterization and comparison with alternative promoters e.g. <bbpart>BBa_J23101</bbpart> Designed for characterisation of XylE in Bacillus subtilis where Pveg is becoming a standard promoter. Parts were assembled in two steps using standard biobrick assembly. false false _440_ 0 7480 9 It's complicated false Parts were assembled in two steps using standard biobrick assembly false IC 2010 Team component2098081 1 BBa_K316001 component2098092 1 BBa_K316003 annotation2098081 1 BBa_K316001 range2098081 1 1 97 annotation2098092 1 BBa_K316003 range2098092 1 106 1166 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1686 1 T7 TE range1686 1 8 27 annotation1690 1 polya range1690 1 28 41 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K316005_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccggtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_J33204_sequence 1 ctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccgg BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K316003_sequence 1 ctcatgaactatgaagaggtgacgtcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctgatggtccggtactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z