BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K143053 1 Pveg-spoVG Promoter Pveg and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Pveg-spoVG was synthesised by GeneArt Released HQ 2013 Constitutive promoter veg(<bbpart>BBa_K143012</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pveg-spoVG can be used in the context of a '''Ribosomes per second''' (RiPS) output generator '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false true _199_ 0 3475 9 In stock false The sequence of Pveg was obtained from the DBTBS<cite>1</cite> and RBS-spoVG were obtained from papers<cite>2</cite> and the sequence synthesised by GeneArt true Chris Hirst component1979395 1 BBa_K143012 component1979397 1 BBa_K143021 annotation1979397 1 BBa_K143021 range1979397 1 106 117 annotation1979395 1 BBa_K143012 range1979395 1 1 97 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K316008 1 BBa_K316008 Cleavable GFP-XylE fusion with Pveg promoter and terminator 2010-10-20T11:00:00Z 2015-05-08T01:11:56Z Existing Biobricks <bbpart>BBa_K143053</bbpart>, <bbpart>BBa_K316005</bbpart>, <bbpart>BBa_B0015</bbpart> This construct is designed so that the XylE activity is substantially reduced untill such a time when a TEV protease is added to the system and transcribed. TEV protease cleavable linker is positioned between the two proteins. Once the linker is cleaved, XylE is free to tetramerise and assume full activity. GFP is His tagged at the 5' end to facilitate purificaiton for in-vitro assays. Terminator <bbpart>BBa_B0014</bbpart> has been added to comply with Biobrick standards. This particular terminator is stronger and is different from <bbpart>BBa_B0015</bbpart>. false false _440_ 0 7480 9 It's complicated false Standard Biobrick assembly false IC 2010 Team component2100972 1 BBa_B0014 component2100965 1 BBa_K316006 component2100957 1 BBa_K143053 annotation2100972 1 BBa_B0014 range2100972 1 1854 1948 annotation2100957 1 BBa_K143053 range2100957 1 1 117 annotation2100965 1 BBa_K316006 range2100965 1 124 1845 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K316006 1 GFP-XylE N-terminus his tagged-GFP-XylE fusion protein 2010-10-20T11:00:00Z 2015-05-08T01:11:56Z Existing biobrick parts with modifications using PCR primer extension Constructed to be combined with promoter and terminator. The GFP is linked to XylE monomer subunit by a GGGSGGGS linker with the aim to render the enzyme inactive, via preventing tetramerization (it???s functional form). false false _440_ 0 7480 9 Not in stock false Standard biobrick assembly and PCR primer extension. For full methods please see our wiki http://2010.igem.org/Team:Imperial_College_London/Strategy false IC 2010 Team annotation2094916 1 His tag range2094916 1 4 21 annotation2094917 1 Start range2094917 1 1 3 annotation2094921 1 GGS linker range2094921 1 778 795 annotation2094922 1 XylE J33204 range2094922 1 796 1722 annotation2094919 1 Flag Tag range2094919 1 733 756 annotation2094920 1 Tev Protease Cleavage Site range2094920 1 757 777 annotation2094918 1 GFP E0040 range2094918 1 22 732 BBa_K316006_sequence 1 atgcatcaccatcatcaccatcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaaggaaaatctttattttcaagggggaggttcaggaggcagcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctaataa BBa_K143053_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K143021_sequence 1 aaaggtggtgaa BBa_K316008_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgcatcaccatcatcaccatcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaaggaaaatctttattttcaagggggaggttcaggaggcagcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z