BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_K316000 1 sRBS Pehs Reverse strand coding Enhanced LacI-hyperspank promoter 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z DNA synthesis by MWG eurofins. The sequence was codon optimized for expression in B.subtilis using mwg ??? eurofins www.eurofinsdna.com proprietary software. This part is a modified version of hyper-spank promoter for B.subtilis <bbpart>BBa_K143015</bbpart>. Hyper-spank promoter is repressed by transcriptional repressor LacI <bbpart>BBa_K143033</bbpart> and can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). Constitutive expression of LacI is required for repression. Promoter Design The position and sequence of LacI binding was designed using existing knowledge. The stochastic nature of transcriptional repressors usually leads to background transcription. In order to minimise background the binding sites and the distance between them have been optimised. Stronger binding The natural LacI operator has 3 binding sites, all of which have variations in the binding sequences. Perfectly symmetric binding sequence was shown to have10-fold higher binding compared to wild type sequences. The aattgtgagc gctcacaatt sequence has been shown to be optimal for LacI binding Muller 1996 Oehler 1994. Optimal distance Due to the tetrameric nature of LacI it can simulataneously bind to multiple regions in the genome. Binding at multple sites can produce much stronger repression (muller 1996) by increasing local LacI concentrations. Due to the helical nature of DNA the distance between the operator sites plays an important role in the strength of repression. Maximal repression at 70.5bp, second strongest at 92.5bp and third at 115.5bp false false _440_ 0 7480 9 It's complicated false Designed for minimal basal transcription by altering the LacI binding site sequence and distance between them. false IC 2010 Team annotation2100978 1 LacI binding range2100978 1 21 51 annotation2100979 1 LacI binding range2100979 1 111 140 annotation2097815 1 sRBS range2097815 1 1 12 annotation2097817 1 scar range2097817 1 13 20 BBa_K316009 1 BBa_K316009 LacI inducible Fast Response Module, using cleavable XylE 2010-10-24T11:00:00Z 2015-05-08T01:11:56Z Made from parts - <bbpart>BBa_k316012</bbpart> and <bbpart>BBa_k316008</bbpart> 5' his tagged GFP-TEV linker-XylE construct is pre-made in the cell under constitutive promoter. Both Pveg promoter and spoVG RBS are best suited for maximal expression in B.subtilis. While GFP is attached to the XylE monomer via the TEV cleavable linker, the catalytic activity is low. Transcription of TEV protease allows cleavage of the linker between GFP and XylE, thus XylE is free to tetramerise into a fully functional enzyme. XylE is then able to act as described in <bbpart>BBa_k316004</bbpart> Please see 'Part Design' section for design considerations and parts used. false false _440_ 0 7480 9 It's complicated false Standard biobrick assembly [http://partsregistry.org/Assembly:Standard_assembly] false IC 2010 Team component2225306 1 BBa_B0014 component2225291 1 BBa_K143053 component2225285 1 BBa_K316017 component2225299 1 BBa_K316006 annotation2225299 1 BBa_K316006 range2225299 1 1006 2727 annotation2225306 1 BBa_B0014 range2225306 1 2736 2830 annotation2225291 1 BBa_K143053 range2225291 1 883 999 annotation2225285 1 BBa_K316017 range2225285 1 1 874 BBa_K316012 1 TEV TEV protease S219P autocatalysis resistant variant 2010-10-22T11:00:00Z 2015-05-08T01:11:56Z TEV protease is naturally found in Tobacco Etch Virus genome. This part contains the sequence codon optimized for expression in B.subtilis using mwg ??? eurofins [[www.eurofinsdna.com]] proprietary software. TEV protease S219P autocatalysis resistant variant Introduction : This is the nuclear inclusion protease, endogenous to Tobacco Etch Virus and is used in the late lifecycle to cleave polyprotein precursors. The recognition sequence is ENLYFQG/S [http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9V-45PMGK3-9P&_user=217827&_coverDate=02%2F01%2F1994&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=e075aad3a349720ad9484095d01a65be&searchtype=a]] between QG or QSDue to it???s stringent sequence specificity, TEV is commonly used to cleave genetically engineered proteins. Uses: TEV proteinase is used to cleave fusion proteins. It is useful due to its high degree of specificity [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6W9V-45PMGK3-9P&_user=217827&_coverDate=02%2F01%2F1994&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=217827&md5=e075aad3a349720ad9484095d01a65be&searchtype=a]] and potential to be used in vivo or in vitro applications. Auto-inactivation Wild type TEV protease also cleaves itself at Met 218 and Ser 219 [[http://www.sciencedirect.com/science?_ob=ArticleURL&_udi=B6WXR-45R86R6-5X&_user=7635175&_coverDate=06%2F20%2F1995&_rdoc=1&_fmt=high&_orig=search&_origin=search&_sort=d&_docanchor=&view=c&_acct=C000011279&_version=1&_urlVersion=0&_userid=7635175&md5=0a1521e783c0bd4126b145f3f6d766d4&searchtype=a]] . This leads to auto-inactivation of the TEV protease and progressive loss of activity of the protein. The rate of inactivation is proportional to the concentration of protease [[http://peds.oxfordjournals.org/content/14/12/993.long ]] More stable Mutants have been produced by single amino acid substitutions S219V (AGC(serine) to GTG(valine) and S219P (AGC(serine) to CCG(proline) Tobacco etch virus protease: mechanism of autolysis and rational design of stable mutants with wild-type catalytic proficiency '''Table I.''' Kinetic parameters for wild-type and mutant TEV proteases with the peptide substrate TENLYFQSGTRR-NH2. Enzyme Km (mM) kcat (s&#8722;1) kcat/Km (mM&#8722;1 s&#8722;1) Wild-type 0.061 ?? 0.010 0.16 ?? 0.01 2.62 ?? 0.46 S219V* 0.041 ?? 0.010 0.19 ?? 0.01 4.63 ?? 1.16 S219P* 0.066 ?? 0.008 0.09 ?? 0.01 1.36 ?? 0.22 S219P* - virtually imperivious to autocatalysis S219V* - retains same activity as wild type Full article can be seen here [[http://peds.oxfordjournals.org/content/14/12/993.long]] false false _440_ 0 7480 9 Not in stock false The part was produced by nucleotide synthesis by mwg ??? eurofin false IC 2010 Team annotation2100977 1 TEV protease range2100977 1 1 717 BBa_K143053 1 Pveg-spoVG Promoter Pveg and RBS spoVG for B. subtilis 2008-10-07T11:00:00Z 2015-05-08T01:10:24Z Pveg-spoVG was synthesised by GeneArt Released HQ 2013 Constitutive promoter veg(<bbpart>BBa_K143012</bbpart>) coupled to the strong Ribosome Binding Site spoVG(<bbpart>BBa_K143021</bbpart>) from ''B. subtilis''. Pveg-spoVG can be used in the context of a '''Ribosomes per second''' (RiPS) output generator '''To get the highest level of translation from this Promoter-RBS combination it must be connected to a coding region preceded by a coding region prefix<cite>1</cite>. A standard prefix will increase the distance between the RBS and the start codon, reducing translational efficiency.''' false true _199_ 0 3475 9 In stock false The sequence of Pveg was obtained from the DBTBS<cite>1</cite> and RBS-spoVG were obtained from papers<cite>2</cite> and the sequence synthesised by GeneArt true Chris Hirst component1979395 1 BBa_K143012 component1979397 1 BBa_K143021 annotation1979397 1 BBa_K143021 range1979397 1 106 117 annotation1979395 1 BBa_K143012 range1979395 1 1 97 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939303 1 BBa_B0012 component939311 1 BBa_B0011 annotation939311 1 BBa_B0011 range939311 1 50 95 annotation939303 1 BBa_B0012 range939303 1 1 41 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K316017 1 BBa_K316017 LacI operator controlled TEV protease 2010-10-24T11:00:00Z 2015-05-08T01:11:56Z The part was produced by nucleotide synthesis by mwg ??? eurofins. The synthetic RBS was designed to work with <bbpart>BBa_K316000</bbpart>. TEV protease S219P autocatalysis resistant variant <bbpart>BBa_K316012</bbpart>. This part had been reversed for the 3' strand in order to reduce any read-through that may be caused by upstream elements. Expression of TEV protease is under control of enhanced hyperspank promoter <bbpart>BBa_K316000</bbpart>. false false _440_ 0 7480 9 It's complicated false TEV protease is naturally found in Tobacco Etch Virus genome. This part contains the sequence codon optimized for expression in B.subtilis using mwg ??? eurofins [http://www.eurofinsdna.com/home.html] proprietary software. false IC 2010 Team component2218945 1 BBa_K316012 component2218950 1 BBa_K316000 annotation2218950 1 BBa_K316000 range2218950 1 726 874 annotation2218945 1 BBa_K316012 range2218945 1 1 717 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K316006 1 GFP-XylE N-terminus his tagged-GFP-XylE fusion protein 2010-10-20T11:00:00Z 2015-05-08T01:11:56Z Existing biobrick parts with modifications using PCR primer extension Constructed to be combined with promoter and terminator. The GFP is linked to XylE monomer subunit by a GGGSGGGS linker with the aim to render the enzyme inactive, via preventing tetramerization (it???s functional form). false false _440_ 0 7480 9 Not in stock false Standard biobrick assembly and PCR primer extension. For full methods please see our wiki http://2010.igem.org/Team:Imperial_College_London/Strategy false IC 2010 Team annotation2094919 1 Flag Tag range2094919 1 733 756 annotation2094921 1 GGS linker range2094921 1 778 795 annotation2094922 1 XylE J33204 range2094922 1 796 1722 annotation2094918 1 GFP E0040 range2094918 1 22 732 annotation2094916 1 His tag range2094916 1 4 21 annotation2094920 1 Tev Protease Cleavage Site range2094920 1 757 777 annotation2094917 1 Start range2094917 1 1 3 BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K316006_sequence 1 atgcatcaccatcatcaccatcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaaggaaaatctttattttcaagggggaggttcaggaggcagcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctaataa BBa_K143053_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_K316000_sequence 1 ttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgag BBa_K316012_sequence 1 ttattagttcattaactgtgtggcctctttaaccggttgaaacggttcttccggtttatccatgaacactttgtgacctccccaaagaacggaatctgcattcagtctccagcctgaaacccattgttgagcttcttggttcgtcagtaactccatgaagttcttgggaacactcgtaaagtaattattcgtattggtgaagtttgacgcagagtgtatgcccacaataaacccatcccgtgttgacacaagaggagagccacattgcccatcttttgtctgaatccaatgcttccaaaagatgccatcagagctagggaatgtacagctagtgtctgataccattgaggacatagatttggtctgaaagtttgttgtgactaagcagatccgttcttcacgctgaggttcgcgaaacttgagtttctgaggaaacggtggaaagtctttcggcattcgaatgataatcatgtctcttccatctatcagatgttgctgaagcgtcgttgtgtttttgaccttaaagactccatgaagggattgtaccaacagtgtaccattattgcgcctaaagaggtgtttgttcgtgatgatgaatggcccaaagccaatgccatacaagctagtggtatgaccatcactctcattggtcagatggcaaatagtcgagctaatcggattatagtcacgtggtcctttaaacaacgatcttcccat BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K143021_sequence 1 aaaggtggtgaa BBa_K316009_sequence 1 ttattagttcattaactgtgtggcctctttaaccggttgaaacggttcttccggtttatccatgaacactttgtgacctccccaaagaacggaatctgcattcagtctccagcctgaaacccattgttgagcttcttggttcgtcagtaactccatgaagttcttgggaacactcgtaaagtaattattcgtattggtgaagtttgacgcagagtgtatgcccacaataaacccatcccgtgttgacacaagaggagagccacattgcccatcttttgtctgaatccaatgcttccaaaagatgccatcagagctagggaatgtacagctagtgtctgataccattgaggacatagatttggtctgaaagtttgttgtgactaagcagatccgttcttcacgctgaggttcgcgaaacttgagtttctgaggaaacggtggaaagtctttcggcattcgaatgataatcatgtctcttccatctatcagatgttgctgaagcgtcgttgtgtttttgaccttaaagactccatgaagggattgtaccaacagtgtaccattattgcgcctaaagaggtgtttgttcgtgatgatgaatggcccaaagccaatgccatacaagctagtggtatgaccatcactctcattggtcagatggcaaatagtcgagctaatcggattatagtcacgtggtcctttaaacaacgatcttcccattactagagttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgagtactagagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatgcatcaccatcatcaccatcgtaaaggagaagaacttttcactggagttgtcccaattcttgttgaattagatggtgatgttaatgggcacaaattttctgtcagtggagagggtgaaggtgatgcaacatacggaaaacttacccttaaatttatttgcactactggaaaactacctgttccatggccaacacttgtcactactttcggttatggtgttcaatgctttgcgagatacccagatcatatgaaacagcatgactttttcaagagtgccatgcccgaaggttatgtacaggaaagaactatatttttcaaagatgacgggaactacaagacacgtgctgaagtcaagtttgaaggtgatacccttgttaatagaatcgagttaaaaggtattgattttaaagaagatggaaacattcttggacacaaattggaatacaactataactcacacaatgtatacatcatggcagacaaacaaaagaatggaatcaaagttaacttcaaaattagacacaacattgaagatggaagcgttcaactagcagaccattatcaacaaaatactccaattggcgatggccctgtccttttaccagacaaccattacctgtccacacaatctgccctttcgaaagatcccaacgaaaagagagaccacatggtccttcttgagtttgtaacagctgctgggattacacatggcatggatgaactatacaaagattataaagatgatgacgacaaggaaaatctttattttcaagggggaggttcaggaggcagcatgaacaaaggtgtaatgcgaccgggccatgtgcagctgcgtgtactggacatgagcaaggccctggaacactacgtcgagttgctgggcctgatcgagatggaccgtgacgaccagggccgtgtctatctgaaggcttggaccgaagtggataagttttccctggtgctacgcgaggctgacgagccgggcatggattttatgggtttcaaggttgtggatgaggatgctctccggcaactggagcgggatctgatggcatatggctgtgccgttgagcagctacccgcaggtgaactgaacagttgtggccggcgcgtgcgcttccaggccccctccgggcatcacttcgagttgtatgcagacaaggaatatactggaaagtggggtttgaatgacgtcaatcccgaggcatggccgcgcgatctgaaaggtatggcggctgtgcgtttcgaccacgccctcatgtatggcgacgaattgccggcgacctatgacctgttcaccaaggtgctcggtttctatctggccgaacaggtgctggacgaaaatggcacgcgcgtcgcccagtttctcagtctgtcgaccaaggcccacgacgtggccttcattcaccatccggaaaaaggccgcctccatcatgtgtccttccacctcgaaacctgggaagacttgcttcgcgccgccgacctgatctccatgaccgacacatctatcgatatcggcccaacccgccacggcctcactcacggcaagaccatctacttcttcgacccgtccggtaaccgcaacgaagtgttctgcgggggagattacaactacccggaccacaaaccggtgacctggaccaccgaccagctgggcaaggcgatcttttaccacgaccgcattctcaacgaacgattcatgaccgtgctgacctaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K316017_sequence 1 ttattagttcattaactgtgtggcctctttaaccggttgaaacggttcttccggtttatccatgaacactttgtgacctccccaaagaacggaatctgcattcagtctccagcctgaaacccattgttgagcttcttggttcgtcagtaactccatgaagttcttgggaacactcgtaaagtaattattcgtattggtgaagtttgacgcagagtgtatgcccacaataaacccatcccgtgttgacacaagaggagagccacattgcccatcttttgtctgaatccaatgcttccaaaagatgccatcagagctagggaatgtacagctagtgtctgataccattgaggacatagatttggtctgaaagtttgttgtgactaagcagatccgttcttcacgctgaggttcgcgaaacttgagtttctgaggaaacggtggaaagtctttcggcattcgaatgataatcatgtctcttccatctatcagatgttgctgaagcgtcgttgtgtttttgaccttaaagactccatgaagggattgtaccaacagtgtaccattattgcgcctaaagaggtgtttgttcgtgatgatgaatggcccaaagccaatgccatacaagctagtggtatgaccatcactctcattggtcagatggcaaatagtcgagctaatcggattatagtcacgtggtcctttaaacaacgatcttcccattactagagttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgag BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z