BBa_K316000 1 sRBS Pehs Reverse strand coding Enhanced LacI-hyperspank promoter 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z DNA synthesis by MWG eurofins. The sequence was codon optimized for expression in B.subtilis using mwg ??? eurofins www.eurofinsdna.com proprietary software. This part is a modified version of hyper-spank promoter for B.subtilis <bbpart>BBa_K143015</bbpart>. Hyper-spank promoter is repressed by transcriptional repressor LacI <bbpart>BBa_K143033</bbpart> and can be induced by addition of Isopropyl &#946;-D-1-thiogalactopyranoside (IPTG). Constitutive expression of LacI is required for repression. Promoter Design The position and sequence of LacI binding was designed using existing knowledge. The stochastic nature of transcriptional repressors usually leads to background transcription. In order to minimise background the binding sites and the distance between them have been optimised. Stronger binding The natural LacI operator has 3 binding sites, all of which have variations in the binding sequences. Perfectly symmetric binding sequence was shown to have10-fold higher binding compared to wild type sequences. The aattgtgagc gctcacaatt sequence has been shown to be optimal for LacI binding Muller 1996 Oehler 1994. Optimal distance Due to the tetrameric nature of LacI it can simulataneously bind to multiple regions in the genome. Binding at multple sites can produce much stronger repression (muller 1996) by increasing local LacI concentrations. Due to the helical nature of DNA the distance between the operator sites plays an important role in the strength of repression. Maximal repression at 70.5bp, second strongest at 92.5bp and third at 115.5bp false false _440_ 0 7480 9 It's complicated false Designed for minimal basal transcription by altering the LacI binding site sequence and distance between them. false IC 2010 Team annotation2097817 1 scar range2097817 1 13 20 annotation2100978 1 LacI binding range2100978 1 21 51 annotation2100979 1 LacI binding range2100979 1 111 140 annotation2097815 1 sRBS range2097815 1 1 12 BBa_K316011 1 BBa_K316011 Reverse strand coding XylE 2010-10-25T11:00:00Z 2015-05-08T01:11:56Z This part is a modified existing biobrick <bbpart>BBa_J33204</bbpart>. This part contains XylE coding on the 3' strand. In many biological settings there may be read-through caused by upstream elements, however this can often be unidirectional. In settings where readthrough from 5' direction is expected to be much stronger than 3' direction, it may is advantageous to use 3' coding sequence instead of traditional 5'. For the purposes of characterisation, the part was made on the minus strand to reduce background transcription. Read-through from 5' direction may provide an additional benefit. Low quantities of anti-sence RNA may be produced as the result of 5' readthrough, which may in turn reduce basal expression sometimes seen in LacI systems. false false _440_ 0 7480 9 Not in stock false Part was designed using several rounds of PCR, using Pfu polymerase to avoid mutations. For more information, please check our wiki[http://2010.igem.org/Team:Imperial_College_London/Strategy]. false IC 2010 Team annotation2107116 1 Start Codon range2107116 1 922 924 annotation2107193 1 XylE Gene range2107193 1 4 924 annotation2107181 1 Stop Codon range2107181 1 1 3 BBa_K316010 1 3 Reverse strand coding XylE under LacI activation 2010-10-21T11:00:00Z 2015-05-08T01:11:56Z Biobricks <bbpart>BBa_K143000</bbpart> and <bbpart>BBa_J33204</bbpart>. The part contains a synthetic RBS optimised for high expression in B subtilis, calculated using RBS calculator [http://voigtlab.ucsf.edu/software/] This part contains XylE under synthetic hyperspank promoter <bbpart>BBa_K143000</bbpart> LacI and IPTG are required for repression and activation of expression. As transformation of B subtilis often requires genomic integration, read-through from upstream genomic regions can become an issue. For the purposes of characterisation, the part was made on the minus strand to reduce background transcription. Read-through may provide an additional benefit as low quantities of anti-sence RNA may reduce basal expression sometimes seen in LacI systems. (although there is some evidence background is usually due to readthrough if have ref) false false _440_ 0 7480 9 It's complicated false to obtain a 3' coding segment a number of PRC steps were required: false IC 2010 Team component2107337 1 BBa_K316011 component2107342 1 BBa_K316000 annotation2107337 1 BBa_K316011 range2107337 1 1 924 annotation2107342 1 BBa_K316000 range2107342 1 933 1081 BBa_K316000_sequence 1 ttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgag BBa_K316011_sequence 1 tcaggtcagcacggtcatgaatcgttcgttgagaatgcggtcgtggtaaaagatcgccttgcccagctggtcggtggtccaggtcaccggtttgtggtccgggtagttgtaatctcccccgcagaacacttcgttgcggttaccggacgggtcgaagaagtagatggtcttgccgtgagtgaggccgtggcgggttgggccgatatcgatagatgtgtcggtcatggagatcaggtcggcggcgcgaagcaagtcttcccaggtttcgaggtggaaggacacatgatggaggcggcctttttccggatggtgaatgaaggccacgtcgtgggccttggtcgacagactgagaaactgggcgacgcgcgtgccattttcgtccagcacctgttcggccagatagaaaccgagcaccttggtgaacaggtcataggtcgccggcaattcgtcgccatacatgagggcgtggtcgaaacgcacagccgccatacctttcagatcgcgcggccatgcctcgggattgacgtcattcaaaccccactttccagtatattccttgtctgcatacaactcgaagtgatgcccggagggggcctggaagcgcacgcgccggccacaactgttcagttcacctgcgggtagctgctcaacggcacagccatatgccatcagatcccgctccagttgccggagagcatcctcatccacaaccttgaaacccataaaatccatgcccggctcgtcagcctcgcgtagcaccagggaaaacttatccacttcggtccaagccttcagatagacacggccctggtcgtcacggtccatctcgatcaggcccagcaactcgacgtagtgttccagggccttgctcatgtccagtacacgcagctgcacatggcccggtcgcattacacctttgttcat BBa_K316010_sequence 1 tcaggtcagcacggtcatgaatcgttcgttgagaatgcggtcgtggtaaaagatcgccttgcccagctggtcggtggtccaggtcaccggtttgtggtccgggtagttgtaatctcccccgcagaacacttcgttgcggttaccggacgggtcgaagaagtagatggtcttgccgtgagtgaggccgtggcgggttgggccgatatcgatagatgtgtcggtcatggagatcaggtcggcggcgcgaagcaagtcttcccaggtttcgaggtggaaggacacatgatggaggcggcctttttccggatggtgaatgaaggccacgtcgtgggccttggtcgacagactgagaaactgggcgacgcgcgtgccattttcgtccagcacctgttcggccagatagaaaccgagcaccttggtgaacaggtcataggtcgccggcaattcgtcgccatacatgagggcgtggtcgaaacgcacagccgccatacctttcagatcgcgcggccatgcctcgggattgacgtcattcaaaccccactttccagtatattccttgtctgcatacaactcgaagtgatgcccggagggggcctggaagcgcacgcgccggccacaactgttcagttcacctgcgggtagctgctcaacggcacagccatatgccatcagatcccgctccagttgccggagagcatcctcatccacaaccttgaaacccataaaatccatgcccggctcgtcagcctcgcgtagcaccagggaaaacttatccacttcggtccaagccttcagatagacacggccctggtcgtcacggtccatctcgatcaggcccagcaactcgacgtagtgttccagggccttgctcatgtccagtacacgcagctgcacatggcccggtcgcattacacctttgttcattactagagttcacctcctttctctagtatgtgaattgttatccgctcacaattccacacacacattatgccacaccttgtagataaagtcaacaacttttgcaactttctcggcaaaatgtggaattgtgagcgctcacaattccacaaccctcgag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z