BBa_K316013 1 PmeI site 8bp recognition sequence for PmeI restriction endonuclease 2010-10-22T11:00:00Z 2015-05-08T01:11:56Z This is a planning part Information about PmeI restriction endonuclease is available at [http://www.neb.com/nebecomm/products/productR0560.asp]. The recognition site is a 8bp sequence GTTTAAAC. Pme produces a blunt cut after GTTT. false false _440_ 0 7480 9 Not in stock false This is a planning part false IC 2010 Team annotation2098160 1 5' product range2098160 1 1 4 annotation2098166 1 3' product range2098166 1 5 8 BBa_K316002 1 Bs dif dif excision site from B. subtilis 2010-10-19T11:00:00Z 2015-05-08T01:11:56Z The dif sites were made by annealing synthestised oligoes. Dif sites are naturally found in B.subtilis and are used by this organism during genome replication. false false _440_ 0 7480 9 Not in stock false The dif site was made by oligos designed to make overhangs for EcoRI and SpeI ( and ) or XbaI and PstI ( and ) to be used in standard Biobrick or 3A cloning. false IC 2010 Team BBa_K316014 1 BBa_K316014 Dif sequence followed by PmeI recognition site 2010-10-22T11:00:00Z 2015-05-08T01:11:56Z Oligonucleotide synthesis of single stranded primers. This composite part of <bbpart>BBa_K143000</bbpart> and <bbpart>BBa_K143013</bbpart>. The dif site can be used in conjunction with another dif site in another part of the vector to remove a sequence between the two dif sites. PmeI site can be used for blunt end cloning of a DNA sequence behind the dif site. Please see ???Part Design??? section for design considerations and parts used. false false _440_ 0 7480 9 It's complicated false This part was designed to be cloned using standard biobrick methods. Two single stranded, synthetic oligos were annealed to produce a double stranded DNA sequence with single stranded overhangs identical to the product of digestion by EcoRI and SpeI. Thus compatible with biobrick cloning methods. false IC 2010 Team component2098249 1 BBa_K316013 component2098246 1 BBa_K316002 annotation2098249 1 BBa_K316013 range2098249 1 37 44 annotation2098246 1 BBa_K316002 range2098246 1 1 28 BBa_K316013_sequence 1 gaaatttc BBa_K316014_sequence 1 atctcctagaatatatattatgtaaacttactagaggaaatttc BBa_K316002_sequence 1 atctcctagaatatatattatgtaaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z