BBa_K143012 1 Pveg Promoter veg a constitutive promoter for B. subtilis 2008-09-10T11:00:00Z 2015-05-08T01:10:23Z The Pveg promoter was suggested to us by Dr. Jan-Willem Veening of Newcastle University. This sequence supplied was compared to that of the DBTBS database<cite>#3</cite> then a section containing the binding site synthesised by Geneart. Released HQ 2013 Pveg is a constitutive promoter that constitutively expresses the P43 protein in ''B.subtilis''. Pveg contains binding sites for the ''B.sutbilis'' major sigma factor<cite>#1</cite>. Pveg in ''B.subtilis'' utilises two binding sites to cause high expression of genes<cite>#2</cite>, however our Pveg is lacking the upstream site to give a medium level of gene expression. It has been noted that the sporulation master regulatoion factor spoOA interacts with Pveg though it is not known how<cite>#3</cite>. The context with which we used the promoter Pveg is as a '''Polymerase Per Second''' (PoPS) generator. false true _199_ 0 2090 9 In stock false The biobrick part was designed to include a single binding site for the ''B.subtilis major sigma factor. In addition the biobrick standard was applied to the promoter Pveg sequence. false James Chappell annotation1975704 1 Sigma A-35 range1975704 1 63 68 annotation1975705 1 Sigma A -10 range1975705 1 86 91 BBa_K143001 1 amyE 5 IS 5??? Integration Sequence for the amyE locus of B. subtilis 2008-08-26T11:00:00Z 2015-05-08T01:10:23Z The 5??? integration sequence was taken from the shuttle vector pDR111 which has been used in many studies on ''B.subtilis'', in particular in the studies of transcriptional control<cite>#1 #2 #3</cite> <biblio> #1 pmid=14597697 #2 pmid=15937167 #3 pmid=12169614 </biblio> Released HQ 2013 The 5' integration sequence can be added to the front of a Biobrick construct and the 3' integration sequence specific for this locus (Part BBa_K143002) to the rear of the Biobrick construct to allow integration of the Biobrick construct into the chromosome of the gram positive bacterium B.subtilis. The AmyE locus was the first locus used for integration into ''B.subtilis'' by Shimotsu and Henner<cite>#1</cite> and is still commonly used in vectors such as pDR111<cite>#2</cite>, pDL<cite>#3</cite> and their derivatives. Integration at the AmyE locus removes the ability of ''B.subtilis'' to break down starch, which can be assayed with iodine as described by Cutting and Vander-horn<cite>#4</cite>. The 5' and 3' integration sequences for the AmyE locus were used to integrate the Imperial 2008 iGEM project primary construct into the ''B.sutbilis'' chromosome. <biblio> #1 pmid=3019840 #2 pmid=14597697 #3 ''Bacillus'' Genetic Stock Center [www.bgsc.org] #4 Cutting, S M.; Vander-Horn, P B. Genetic analysis. In: Harwood C R, Cutting S M. , editors. Molecular biological methods for Bacillus. Chichester, England: John Wiley & Sons, Ltd.; 1990. pp. 27???74. </biblio> false false _199_ 0 3475 9 In stock true The AmyE integration sequence was taken from the vector after comparison by BLAST to the ''B.subtilis'' chromosome to identify the homologous sequences. The sequence present in both the host chromosome and the plasmid at the 5' end of the gene is the 5' sequence required for integration. true Chris Hirst annotation1974145 1 5' AmyE homologous sequence range1974145 1 1 522 BBa_J31005 1 CmR chloramphenicol acetyltransferase (forwards, CmF) [cf. BBa_J31004] 2006-07-11T11:00:00Z 2015-08-31T04:08:45Z pSB1AC3 When a promoter and an RBS are in front of the gene, the cell will express Chloramphenicol resistance. Because it contains full biobrick ends, this part can be used to easily add chloramphenicol resistance to any part without changing plasmid vectors. false true _61_ 0 918 61 In stock true This part is cloned into pSB1A2. true Erin Zwack, Sabriya Rosemond annotation1884999 1 CmR gene range1884999 1 1 660 BBa_K143021 1 RBS-spoVG SpoVG ribosome binding site (RBS) for B. subtilis 2008-09-16T11:00:00Z 2015-05-08T01:10:23Z The sequence was taken from a previous research paper [1] and was constructed by Geneart. Released HQ 2013 Description: SpoVG is an endogenous ribosome binding site from B.subtilis. The sequence of the spoVG ribosome binding site is AAAGGUGGUGA which is complementary to the sequence UUUCCUCCACU from the 3' region of the 16s rRNA from B.subtilis. Previous research showed that the predicted binding energy of the 16s rRNA to the RBS is -19kcal <cite>1</cite> false true _199_ 0 2090 9 In stock false In order to ensure that the RBS is functional the actual ribosome binding site was maintained and the distance between the RBS and the start codon maintained. In order to conform to the biobrick standard the sequence flanking the RBS had to be changed but the distance between the promoter and RBS, and start codon and RBS was maintained. false James Chappell annotation1975997 1 rbs range1975997 1 1 12 BBa_K143070 1 BBa_K143070 AmyE integratable PoPS generator (Pveg-spoVG) 2008-10-27T12:00:00Z 2015-05-08T01:10:24Z The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector utilising Pfu DNA polymerase and cloned into a BioBrick with the Pveg-spoVG that was synthesised by GeneArt. AmyE 5' Integration sequence(<bbpart>BBa_K143001</bbpart>) coupled to the PoPS generator Pveg-spoVG (<bbpart>BBa_K143053</bbpart>). The amyE 5' integration sequence allows integration into the ''B. subtilis'' genome at the amyE locus if the 3' amyE integration sequence(<bbpart>BBa_K143002</bbpart>) is cloned onto the 3' end of the construct. The Pveg-spoVG promoter and RBS for ''B. subtilis'' constitutively generate a PoPS output. false false _199_ 0 3475 9 It's complicated false The amyE 5' integration sequence was PCR cloned from the ''B. subtilis'' integration vector pDR111 utilising Pfu DNA polymerase. The sequence of Pveg-spoVG was obtained from papers. false Chris Hirst component1990784 1 BBa_K143012 component1990786 1 BBa_K143021 component1990781 1 BBa_K143001 annotation1990781 1 BBa_K143001 range1990781 1 1 522 annotation1990786 1 BBa_K143021 range1990786 1 636 647 annotation1990784 1 BBa_K143012 range1990784 1 531 627 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K143064 1 CmR-T Chloramphenicol resistance protein - Terminator 2008-10-08T11:00:00Z 2015-05-08T01:10:24Z The Chloraphemicol acetyltransferase and double terminator were taken both taken from the registry. Chloraphemicol acetyltransferase protein(<bbpart>BBa_J31005</bbpart>) coupled to the double terminator (<bbpart>BBa_B0015</bbpart>). Chloraphemicol acetyltransferase confers resistance to Chloraphemicol. The double terminator is the most commonly used terminator and is a combination of parts <bbpart>BBa_B0010</bbpart> and <bbpart>BBa_B0012</bbpart>. The double terminator allows the CAT to be incorporated into a closed transcriptional unit. false true _199_ 0 3475 9 It's complicated true Chloraphemicol acetyltransferase is an exisiting registry protein. The double terminator is the most commonly used registry termiantor. true Chris Hirst component1980003 1 BBa_J31005 component1980004 1 BBa_B0010 component1980006 1 BBa_B0012 annotation1980006 1 BBa_B0012 range1980006 1 757 797 annotation1980003 1 BBa_J31005 range1980003 1 1 660 annotation1980004 1 BBa_B0010 range1980004 1 669 748 BBa_K316023 1 BBa_K316023 Chloraphenicol resistance gene with 5amyE 2010-10-22T11:00:00Z 2015-05-08T01:11:56Z iobrick parts <bbpart>BBa_K143070</bbpart> (which contains <bbpart>BBa_K143001</bbpart>, <bbpart>BBa_K316012</bbpart>, <bbpart>BBa_K143021</bbpart>) and <bbpart>BBa_K143064</bbpart> (which contains <bbpart>BBa_K143031</bbpart>, <bbpart>BBa_B0015</bbpart>) <bbpart>BBa_K143001</bbpart> integration sequence allows integration into B. subtilis genome, which disrupts ability to breakdown starch. In order for integration to occur, 3' amyE integration sequence <bbpart>BBa_K143002</bbpart> is also required. This part can be used as the 5' start of an amyE integration vector, the genes of interest can then be attached to the 3' end, followed by the 3' amye integratio sequwnce <bbpart>BBa_K143002</bbpart>. false false _440_ 0 7480 9 It's complicated false Parts combined by standard biobrick assembly [http://partsregistry.org/Assembly:Standard_assembly] false IC 2010 Team component2097176 1 BBa_K143070 component2097185 1 BBa_K143064 annotation2097176 1 BBa_K143070 range2097176 1 1 647 annotation2097185 1 BBa_K143064 range2097185 1 654 1450 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K143070_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcgatactagagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaa BBa_K143064_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143021_sequence 1 aaaggtggtgaa BBa_K316023_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcgatactagagaattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagaaaggtggtgaatactagatggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K143012_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_J31005_sequence 1 atggagaaaaaaatcactggatataccaccgttgatatatcccaatggcatcgtaaagaacattttgaggcatttcagtcagttgctcaatgtacctataaccagaccgttcagctggatattacggcctttttaaagaccgtaaagaaaaataagcacaagttttatccggcctttattcacattcttgcccgcctgatgaatgctcatccggaatttcgtatggcaatgaaagacggtgagctggtgatatgggatagtgttcacccttgttacaccgttttccatgagcaaactgaaacgttttcatcgctctggagtgaataccacgacgatttccggcagtttctacacatatattcgcaagatgtggcgtgttacggtgaaaacctggcctatttccctaaagggtttattgagaatatgtttttcgtctcagccaatccctgggtgagtttcaccagttttgatttaaacgtggccaatatggacaacttcttcgcccccgttttcaccatgggcaaatattatacgcaaggcgacaaggtgctgatgccgctggcgattcaggttcatcatgccgtttgtgatggcttccatgtcggcagaatgcttaatgaattacaacagtactgcgatgagtggcagggcggggcgtaa BBa_K143001_sequence 1 atgtttgcaaaacgattcaaaacctctttactgccgttattcgctggatttttattgctgtttcatttggttctggcaggaccggcggctgcgagtgctgaaacggcgaacaaatcgaatgagcttacagcaccgtcgatcaaaagcggaaccattcttcatgcatggaattggtcgttcaatacgttaaaacacaatatgaaggatattcatgatgcaggatatacagccattcagacatctccgattaaccaagtaaaggaagggaatcaaggagataaaagcatgtcgaactggtactggctgtatcagccgacatcgtatcaaattggcaaccgttacttaggtactgaacaagaatttaaagaaatgtgtgcagccgctgaagaatatggcataaaggtcattgttgacgcggtcatcaatcataccaccagtgattatgccgcgatttccaatgaggttaagagtattccaaactggacacatggaaacacacaaattaaaaactggtctgatcga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z