BBa_B0011 1 BBa_B0011 LuxICDABEG (+/-) 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from luxICDABEG operon terminator of Vibrio fischeri <genbank>AF170104</genbank>. Released HQ 2013 Bidirectional transcriptional terminator consisting of a 22 bp stem-loop.</p> false false _1_ 0 24 7 In stock false <P> <P>In the naturally-occuring sequence there is a mismatch in the stem of the stem loop. This can be corrected via an A-&gt;G mutation (at position 40 -- sequence coordinate/not MFOLD coordinate). The above sequence does not reflect this mutation (but the MFOLD image does). This terminator's location cannot be found using some inverted repeat detectors like PALINDROME because it is too short and contains a mismatch. This one was found with the help of Tom Knight. It lies between two coding regions that point towards eachother.<P> true Reshma Shetty annotation1683 1 stem_loop range1683 1 13 35 annotation7019 1 BBa_B0011 range7019 1 1 46 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_K316045 1 LytC-Gly-E LytC - Glycine Linker - Elastase Cleavage Site - AIP - His Tag 2010-10-26T11:00:00Z 2015-05-08T01:11:57Z source intro false false _440_ 0 7480 9 Not in stock false design false IC 2010 Team annotation2107960 1 start range2107960 1 22 24 annotation2109929 1 His Tag range2109929 1 1075 1092 annotation2109931 1 Stop Codon range2109931 1 1096 1098 annotation2107965 1 LytC Cell Wall Binding Domain range2107965 1 22 976 annotation2109927 1 Elastase Cleavage Site range2109927 1 1012 1023 annotation2109930 1 Stop Codon range2109930 1 1093 1095 annotation2107927 1 sRBS range2107927 1 1 15 annotation2109926 1 Glycine Linker range2109926 1 977 1011 annotation2109928 1 Auto Inducing Peptide range2109928 1 1024 1074 BBa_K316001 1 Pveg pVeg Constitutive promoter for Veg locus from B. subtilis 2010-10-11T11:00:00Z 2015-05-08T01:11:56Z PCR from existing biobrick K143053 using Pfu polymerase II Released HQ 2013 This part is identical to the sequence submitted by Imperial 2008 team, this part was produced from K143053 by PCR. PVeg is a constitutive promoter controlled by Sigma factor A. This promoter has two binding sites which leads to high expression of downstream genes. There is some evidence that the sporulation master regulator the spoOA can interact with pVeg although the mechanism is not known. false false _440_ 0 7480 9 In stock false PCR using Pfu polymerase to avoid mutations false IC 2010 Team annotation2085549 1 Sigma A-35 range2085549 1 63 68 annotation2085550 1 Sigma A-35 range2085550 1 86 91 BBa_K316035 1 P-RBS-CWB- Pveg-spoVG-LytC-Glycine Linker-Elastase Cleavage Site-AIP-His Tag 2010-10-25T11:00:00Z 2015-05-08T01:11:57Z source long false false _440_ 0 7480 9 Not in stock false Please see main page false IC 2010 Team component2111970 1 BBa_K316045 component2111977 1 BBa_B0014 component2111960 1 BBa_K316001 annotation2111977 1 BBa_B0014 range2111977 1 1212 1306 annotation2111970 1 BBa_K316045 range2111970 1 106 1203 annotation2111960 1 BBa_K316001 range2111960 1 1 97 BBa_B0014 1 BBa_B0014 double terminator (B0012-B0011) 2003-07-15T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0012 and BBa_B0011 false true _1_ 0 24 7 In stock false true Reshma Shetty component939311 1 BBa_B0011 component939303 1 BBa_B0012 annotation939303 1 BBa_B0012 range939303 1 1 41 annotation939311 1 BBa_B0011 range939311 1 50 95 BBa_K316035_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgttactagagtcttcagaaaggagttactagatgcgttcttatataaaagtcctaacaatgtgttttctggggctcatactttttgtgccaacagctttggccgataactcagtgaaaagagttgggggaagcaatagatacggcactgctgtacaaatatcaaagcaaatgtattcaacagcaagtacagctgtaattgttggtgggagttcctatgcagatgctatttcagcagcacctcttgcttaccagaagaatgcgccattgctttacactaattctgataagctttcatatgaaacgaaaacaagattgaaagagatgcagactaaaaatgtaattattgtaggcggaacacctgctgtttcttctaacactgctaaccagattaaaagcttggggataagtattaaacgaattgcaggaagcaaccgttatgatacggctgcacgggtggcaaaagcgatgggtgcgacttcaaaagctgttattttgaacggcttcttatatgcagacgctccggccgtcatcccttatgcagcgaaaaacgggtatccaattctttttacaaataaaacatctataaatagtgcgactacgtctgtgataaaagataagggaatttcgagtaccgttgttgtaggaggcactggaagtatcagcaatacggtatacaacaagttaccttctcctacaagaattagcggttcaaacagatatgagcttgctgcaaatatcgtacaaaaacttaatttatcaacaagcaccgtatatgtaagcaatggattcagctaccctgactctattgcaggagctacactggcagctaagaagaagcaatctcttattcttacaaatggtgaaaatttatctacaggagcccgtaaaattattggaagtaaaaacatgtcaaactttatgattatcggaaacactcctgccgtaagcacaaaggttgctaatcagctaaagaatccagttgtaagccgcggatcaagagcaggtggaggcggaggcggctcatggccgctggaaatgcgtctgtcaaaattctttcgcgattttattcttcaaagaaaaaagcatcaccatcatcaccattaataatactagagtcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_B0014_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttatatactagagagagaatataaaaagccagattattaatccggcttttttattattt BBa_K316001_sequence 1 aattttgtcaaaataattttattgacaacgtcttattaacgttgatataatttaaattttatttgacaaaaatgggctcgtgttgtacaataaatgt BBa_K316045_sequence 1 tcttcagaaaggagttactagatgcgttcttatataaaagtcctaacaatgtgttttctggggctcatactttttgtgccaacagctttggccgataactcagtgaaaagagttgggggaagcaatagatacggcactgctgtacaaatatcaaagcaaatgtattcaacagcaagtacagctgtaattgttggtgggagttcctatgcagatgctatttcagcagcacctcttgcttaccagaagaatgcgccattgctttacactaattctgataagctttcatatgaaacgaaaacaagattgaaagagatgcagactaaaaatgtaattattgtaggcggaacacctgctgtttcttctaacactgctaaccagattaaaagcttggggataagtattaaacgaattgcaggaagcaaccgttatgatacggctgcacgggtggcaaaagcgatgggtgcgacttcaaaagctgttattttgaacggcttcttatatgcagacgctccggccgtcatcccttatgcagcgaaaaacgggtatccaattctttttacaaataaaacatctataaatagtgcgactacgtctgtgataaaagataagggaatttcgagtaccgttgttgtaggaggcactggaagtatcagcaatacggtatacaacaagttaccttctcctacaagaattagcggttcaaacagatatgagcttgctgcaaatatcgtacaaaaacttaatttatcaacaagcaccgtatatgtaagcaatggattcagctaccctgactctattgcaggagctacactggcagctaagaagaagcaatctcttattcttacaaatggtgaaaatttatctacaggagcccgtaaaattattggaagtaaaaacatgtcaaactttatgattatcggaaacactcctgccgtaagcacaaaggttgctaatcagctaaagaatccagttgtaagccgcggatcaagagcaggtggaggcggaggcggctcatggccgctggaaatgcgtctgtcaaaattctttcgcgattttattcttcaaagaaaaaagcatcaccatcatcaccattaataa BBa_B0011_sequence 1 agagaatataaaaagccagattattaatccggcttttttattattt BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z