BBa_K317000 1 BBa_K317000 SRII (NpSRII) 2010-10-18T11:00:00Z 2015-05-08T01:11:57Z Natronomonas pharaonis (Obtained from National Institute of Technology and Evaluation(NBRC). (NBRC 14720T)) Halobacteria exhibit phototaxis responses to changes in light intensity and color using the seven-transmembrane retinylidene photoreceptors sensory rhodopsins I and II (SRI and SRII).Light-activated SRI and SRII transmit signals to their cognate transducers, HtrI and HtrII, respectively. The Htr proteins contain two transmembrane helices and cytoplasmic methyl-accepting and His-kinase-activating domains homologous to those of chemotaxis transducers of eubacteria,such as the Escherichia coli and Salmonella enterica serovar Typhimurium Tsr and Tar, chemotaxis transducers for serine and aspartate, respectively. Sensory rhodopsin II from Natronobacterium pharaonis (NpSRII) is very similar in spectroscopic and functional properties to the repellent receptor SRII in Halobacterium salinarum, and it has been found to be more stable in response to variation in external conditions such as pH and ionic strength. The NpSRII protein mediates a repellent response to blue-green light (maximum λ,497 nm) when it is coexpressed with its transducer, NpHtrII, in　H. salinarum. Also, when expressed in E. coli, NpSRII is capable of binding all-trans retinal to form a blue-green-lightabsorbing pigment. false false _436_ 0 4686 9 It's complicated false The coding sequence was amplified with primer sets which were designed based on 'Standard part fabrication' described in http://openwetware.org/wiki/Synthetic_Biology:BioBricks/Part_fabrication false Yoshiyuki MURAKAMI BBa_K317000_sequence 1 atggtgggacttacgaccctcttttggctcggcgcaatcggcatgctcgtcggcacgctcgcgttcgcgtgggccggccgtgacgccggaagcggcgagcgacggtactacgtgacacttgtcggcatcagtggtatcgcagcagtcgcctacgccgttatggcgctgggtgtcggctgggttcccgtggccgaacggactgttttcgtcccccggtacatcgactggattctcacaaccccgctcatcgtctacttcctcgggctgcttgcggggcttgatagtcgggagttcggcatcgtcatcacgctcaacaccgtggtcatgctcgccggcttcgccggggcgatggtgcccggtatcgagcgctacgcgctgttcggcatgggggcggtcgcattcatcggactggtctactacctcgtcgggccgatgaccgaaagcgccagccagcggtcctccggaatcaagtcgctgtacgtccgcctccgaaacctgacggtcgtcctctgggcgatttatccgttcatctggctgcttggaccgccgggcgtggcgctgctgacaccgactgtcgacgtggcgcttatcgtctaccttgacctcgtcacgaaggtcgggttcggcttcatcgcactcgatgctgcggcgacacttcgggccgaacacggcgaatcgctcgctggcgtcgatactgacacgcctgcggtcgccgactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z