BBa_K317022 1 BBa_K317022 Fe-ion-binding peptide 2010-10-18T11:00:00Z 2015-05-08T01:11:57Z this peptide came from human genome sequence. this peptide has the function binding Fe-ion. false false _436_ 0 7146 9 Not in stock false syn116~140 false Rei Toda BBa_K317022_sequence 1 atgatgcctgtggatcctgacaatgaggcttatgaaatgccttctgaggaagggtatcaagactacgaacctgaagcctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z