BBa_K318021 1 BBa_K318021 pLac + RBS + Hin 2010-07-12T11:00:00Z 2015-05-08T01:11:57Z biobricks This composite part is an inducible Hin DNA recombinase generator which acts on the hixC recombination sites. It is composed of the following biobricks: BBa_K200021, BBa_J31000. Note that to fully repress the pLac promoter, overproduction of the lacI repressor protein is necessary. false false _438_ 0 4845 9 Not in stock false Note that to fully repress the pLac promoter, overproduction of the lacI repressor protein is necessary. false Nathaniel Pantalone, Justin Vrana component2073473 1 BBa_B0034 component2073479 1 BBa_J31000 component2073467 1 BBa_R0011 annotation2073473 1 BBa_B0034 range2073473 1 64 75 annotation2073467 1 BBa_R0011 range2073467 1 1 54 annotation2073479 1 BBa_J31000 range2073479 1 82 654 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2000 1 -35 range2000 1 20 25 annotation2001 1 lac O1 range2001 1 26 42 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2002 1 -10 range2002 1 43 48 annotation1999 1 lac O1 range1999 1 3 19 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_J31000 1 Hin DNA-invertase Hin from Salmonella typhimurium 2006-06-04T11:00:00Z 2015-08-31T04:08:45Z Salmonella typhimurium Generates the Salmonella typhimurium Hin protein. This protein is used to invert DNA that is flanked by Hix siteds. false false _61_ 0 918 61 It's complicated false none really false Erin Zwack, Sabriya Rosemond annotation1884987 1 Hin sequence range1884987 1 1 573 annotation1880459 1 Former SpeI site range1880459 1 70 75 annotation1910569 1 Rev primer J31001 range1910569 1 551 570 annotation1910568 1 Fwd primer J31001 range1910568 1 1 3 annotation1880460 1 Mutation to delete the SpeI site range1880460 1 72 72 BBa_B0034_sequence 1 aaagaggagaaa BBa_K318021_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa BBa_J31000_sequence 1 atggctactattgggtatattcgggtgtcaacaattgaccaaaatatcgatttacagcgtaatgcgcttaccagtgcaaattgtgaccgcatttttgaagaccgtatcagtggcaagattgcaaaccgccccggcctgaaacgggcgttaaagtatgtaaataaaggcgatactcttgtcgtctggaaattagacagactgggccgtagcgtgaaaaatctggtggcgttaatatcagaattacatgaacgtggagctcacttccattctttaaccgatagtattgataccagtagcgcgatggggcgattcttttttcatgtaatgtcagcactggccgagatggagcgagaattaatcgtcgagcgaacccttgccggactggctgccgccagagcgcaaggacgactgggagggcgccctcgggcgatcaacaaacatgaacaggaacagattagtcggctattagagaaaggccatcctcggcagcaattagctattatttttggtattggcgtatccaccttatacagatactttccggcaagcagtataaaaaaacgaatgaattaa BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z