BBa_J3101 1 RE Recombinational Enhancer (RE) for Hin/Hix inverting 2006-06-01T11:00:00Z 2015-08-31T04:08:45Z false false _61_ 0 918 61 In stock true true Erin Zwack, Sabriya Rosemond annotation1880472 1 Mutation of SpeI site range1880472 1 51 51 annotation1884992 1 Distal Fis Binding Site range1884992 1 55 69 annotation1880471 1 Former SpeI site range1880471 1 51 56 annotation1884989 1 Originally a C range1884989 1 29 29 annotation1884990 1 Insertion right before biobrick ends range1884990 1 77 77 annotation1884988 1 RE Sequence range1884988 1 1 77 annotation1884991 1 Proximal Fis Binding Site range1884991 1 6 21 BBa_J44000 1 hixC hixC binding site for Salmonella typhimurium Hin recombinase 2006-06-05T11:00:00Z 2015-08-31T04:08:48Z Nanassy and Hughes. 1998. In Vivo Identification of Intermediate Stages of the DNA Inversion Reaction Catlyzed by the Salmonella Hin Recombinase [http://www.genetics.org/cgi/content/abstract/149/4/1649] A 26 bp sequence of DNA composed of 12 bp inverted repeats and a 2 bp core that operates in Salmonella paired with a hixR binding site to recombine DNA. A second hix site is required for recombination to occur. The two sites bind Hin recombinase in the formation of an invertasome. false true _71_ 0 606 61 In stock true Standard BioBrick prefix and suffix were added to the 26 bp sequence. true Missouri Western and Davidson Groups, Todd Eckdahl BBa_K318028 1 BBa_K318028 hixC + pCons + lox66 + Hin enhancer + SapI + lox71 + hixC 2010-07-12T11:00:00Z 2015-05-08T01:11:58Z From synthesis. This composite part is a prefix testing cassette for Hin recombination by flipping and Cre recombination by deletion. false false _438_ 0 6061 9 Not in stock false The SapI restriction site can be used to insert DNA with ATC sticky ends in order to modify the length of recombination. false Justin Vrana, Nate Pantalone component2073466 1 BBa_J44000 component2073457 1 BBa_I718016 component2073456 1 BBa_J23100 component2073464 1 BBa_J3101 component2073455 1 BBa_J44000 component2073465 1 BBa_I718017 annotation2073455 1 BBa_J44000 range2073455 1 1 26 annotation2073457 1 BBa_I718016 range2073457 1 78 111 annotation2073465 1 BBa_I718017 range2073465 1 205 238 annotation2073466 1 BBa_J44000 range2073466 1 247 272 annotation2073456 1 BBa_J23100 range2073456 1 35 69 annotation2073464 1 BBa_J3101 range2073464 1 120 196 BBa_I718017 1 lox71 lox71 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed Released HQ 2013 Lox71 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularly in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox71 and a lox66 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox71 & lox66 sites is potentially interesting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modifaication was made on lox71 sequence true Eimad Shotar BBa_J23100 1 BBa_J23100 constitutive promoter family member 2006-08-03T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Replace later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_I718016 1 lox66 lox66 2007-10-25T11:00:00Z 2015-08-31T04:07:52Z This part was generated in the form of a forward & a reverse primer. After annealing these primers EcoRI & PstI compatible cohesive ends at the 5' & 3' ends of the dsDNA were generated. Next, the dsDNA was subcloned in a pSB1A2 open plasmid (digested with EcoRI & PstI) You can follow the construction process by following the links available in the Paris iGEM 2007 wiki: http://parts.mit.edu/igem07/index.php/Paris "freezer" section plasmids table. A links sends you to the corresponding notebook date when the ligation reaction was performed lox66 is a site specific recombination cassette. It belongs to the loxP family frequently used in genetics, particularily in mouse genetics. lox site recombination is catalysed by a Site specific recombinase, Cre. lox sequences are composed of an 8 bp Core sequence surrounded by two Arms. The particularity of lox66 is that it has an altered sequence at the end of it's left arm compared to loxP. This sequence variation reduces affinity of the Cre recombinase for the arm. As a consequence, after a recombination between a lox66 and a lox71 (altered right arm sequence), one of the two resulting generated lox sites has very low recombination potential as it inherited both mutated arms. Use of lox66 & lox71 sites is potentially interresting when the recombination reaction must be "irreversible". false false _141_ 0 1568 9 In stock false No modidification was made on the lox66 sequence true Eimad Shotar BBa_J23100_sequence 1 ttgacggctagctcagtcctaggtacagtgctagc BBa_I718017_sequence 1 taccgttcgtatacgatacattatacgaagttat BBa_K318028_sequence 1 ttatcaaaaaccatggtttttgataatactagagttgacggctagctcagtcctaggtacagtgctagctactagagataacttggtatagcatacattatacgaacggtatactagagttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttgtactagagtaccgttcgtatacgatacattatacgaagttattactagagttatcaaaaaccatggtttttgataa BBa_J44000_sequence 1 ttatcaaaaaccatggtttttgataa BBa_J3101_sequence 1 ttcgggtgtcaacaattgaccaaaatattgatttacagcgtaatgcgctttctagtgcaaattgtgaccgcattttg BBa_I718016_sequence 1 ataacttggtatagcatacattatacgaacggta igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z