BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 BBa_K200002 1 ygiV Colanic acid global regulator -> ygiV (B3023) 2009-08-11T11:00:00Z 2015-05-08T01:11:21Z NCBI Reference Sequence: NC_000913.2 >gi|49175990:3166771-3167253 Escherichia coli str. K-12 substr. MG1655, complete genome The putative transcription factor B3023 acts as a repressor for the yncC promoter. YncC increases biofilm formation by repressing overproduction of the exopolysaccharide identified as colanic acid. Therefore B3023 increases the production of colanic acid by blocking YncC. false false _298_ 0 5277 9 It's complicated false The sequence of NCBI is the reverse compliment. false James Field annotation2018132 1 stop range2018132 1 481 483 annotation2018131 1 cds range2018131 1 1 480 annotation2027405 1 stop range2027405 1 484 486 annotation2018130 1 start range2018130 1 1 3 BBa_K137113 1 rcsA rcsA 2008-09-23T11:00:00Z 2015-05-08T01:10:11Z DH10B genomic DNA. rcsA is a gene responsible for regulating capsule synthesis. It has also been shown to induce lambda lysogens into the lytic cycle. false false _187_ 0 2988 9 It's complicated false N/A false Fei Chen BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K318599 1 BBa_K318599 lacI pL + RBS + RcsB + RBS + RcsA + TT 2010-07-17T11:00:00Z 2015-05-08T01:11:58Z uc uc true false _438_ 0 4504 9 Discontinued false uc false Sarah R. Sandock component2074262 1 BBa_K137113 component2074263 1 BBa_B0010 component2074254 1 BBa_B0034 component2074261 1 BBa_B0034 component2074259 1 BBa_K200002 component2074248 1 BBa_R0011 component2074265 1 BBa_B0012 annotation2074254 1 BBa_B0034 range2074254 1 64 75 annotation2074261 1 BBa_B0034 range2074261 1 576 587 annotation2074248 1 BBa_R0011 range2074248 1 1 54 annotation2074262 1 BBa_K137113 range2074262 1 594 1217 annotation2074265 1 BBa_B0012 range2074265 1 1314 1354 annotation2074263 1 BBa_B0010 range2074263 1 1226 1305 annotation2074259 1 BBa_K200002 range2074259 1 82 567 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K318599_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagatgacaaacctgacactggatgtaaacattatcgatttcccatcaatacctgtggcgatgttgccgcaccgctgtagccctgaattgctcaactacagcgtggcgaaatttatcatgtggcgtaaagagacggggctttctcctgttaaccaaagccagacttttggcgtcgcctgggacgaccctgccaccaccgcaccggaagcgtttcgctttgatatctgcggcagcgttagcgaaccgattcccgataatcgttatggtgtgagcaatggtgaacttaccggtggacgttatgccgtggcccgccacgttggcgagctggacgatatttcacacacggtatggggcatcattcgccactggctgcctgcaagcggcgagaaaatgcgtaaagcaccgattctgtttcactacaccaatcttgccgaaggggtgacagagcagcgactggaaacggatgtttatgtgccgttggcgtgataatactagagaaagaggagaaatactagatgtcaacgattattatggatttatgtagttacacccgactaggtttaaccgggtatctgttgagtagaggggttaaaaaaagagaaatcaacgacattgaaaccgttgatgaccttgccatagcttgtgattcacagcgcccttcagtggtgtttattaatgaggactgtttcatccacgatgcttctaacagtcagcgtatcaagctcatcattaatcaacatcccaatacgttatttatcgtttttatggcaattgccaatgttcattttgatgaatatctattggtcagaaaaaatttattgatcagttctaaatcgattaaaccggaatctctcgacgatatccttggcgatattctgaaaaaagagacaacgataacctcgtttttaaatatgccgacgttatcattgagccgaaccgaatcgagtatgttgcgaatgtggatggcaggtcagggaaccattcaaatctctgaccaaatgaatatcaaagccaagaccgtttcatcgcataaaggtaatattaaacgtaagatcaaaacgcataataaacaggttatctaccatgtcgtccgactgacggataatgtgactaatggtatttttgtcaacatgcgctaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0034_sequence 1 aaagaggagaaa BBa_K137113_sequence 1 atgtcaacgattattatggatttatgtagttacacccgactaggtttaaccgggtatctgttgagtagaggggttaaaaaaagagaaatcaacgacattgaaaccgttgatgaccttgccatagcttgtgattcacagcgcccttcagtggtgtttattaatgaggactgtttcatccacgatgcttctaacagtcagcgtatcaagctcatcattaatcaacatcccaatacgttatttatcgtttttatggcaattgccaatgttcattttgatgaatatctattggtcagaaaaaatttattgatcagttctaaatcgattaaaccggaatctctcgacgatatccttggcgatattctgaaaaaagagacaacgataacctcgtttttaaatatgccgacgttatcattgagccgaaccgaatcgagtatgttgcgaatgtggatggcaggtcagggaaccattcaaatctctgaccaaatgaatatcaaagccaagaccgtttcatcgcataaaggtaatattaaacgtaagatcaaaacgcataataaacaggttatctaccatgtcgtccgactgacggataatgtgactaatggtatttttgtcaacatgcgctaa BBa_K200002_sequence 1 atgacaaacctgacactggatgtaaacattatcgatttcccatcaatacctgtggcgatgttgccgcaccgctgtagccctgaattgctcaactacagcgtggcgaaatttatcatgtggcgtaaagagacggggctttctcctgttaaccaaagccagacttttggcgtcgcctgggacgaccctgccaccaccgcaccggaagcgtttcgctttgatatctgcggcagcgttagcgaaccgattcccgataatcgttatggtgtgagcaatggtgaacttaccggtggacgttatgccgtggcccgccacgttggcgagctggacgatatttcacacacggtatggggcatcattcgccactggctgcctgcaagcggcgagaaaatgcgtaaagcaccgattctgtttcactacaccaatcttgccgaaggggtgacagagcagcgactggaaacggatgtttatgtgccgttggcgtgataa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z