BBa_K319006 1 BBa_K319006 ACT1 distal promoter 2010-10-19T11:00:00Z 2015-05-08T01:11:58Z This part was extracted from S. cerevisiae genome by colony PCR. The primers were designed according to the genomic sequence available from SGD. This is the distal portion of the native S. cerevisiae ACT1 promoter. false false _437_ 0 7363 9 It's complicated false N/A false Afnan Azizi BBa_K319006_sequence 1 ggaaaggatcaaacaaacccaaaaatatttcaaaaaggagagagagaggcgagtttggtttcaaaacggtttatttatttatgcaagaggacgtggaagaaaaagaagaaggaagaaaaaaatttgaaagaaaaaaacgcgtggcgggtaaagaagaaaatggaaaatagaggccgggtgacagagaaatattgagggttaattggaaaatatgttagggtgaggcatatgtttttaagggttttgaggatccgataaggaagaatgtaggtt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z