BBa_K319019 1 BBa_K319019 yeast L3 Proximal Promoter 2010-10-19T11:00:00Z 2015-05-08T01:11:58Z The part was amplified via colony PCR from a YPH500 strain of S. cerevisiae. The strain expressing the part was given to us by Tom Ellis. The proximal L promoter was constructed with a Lac operator (lacO) from the K-12 E.coli strain in addition to the TATA box and start site of the GAL1 promoter. The yeast promoter is repressed by a eukaryotic-optimized version of the E.coli Lac inhibitor and inducible with IPTG. The promoter was constructed with runs of unspecified ("N") sequence separating motifs and fixed Lac operator and GAL1 motifs. The unspecified motifs modulate the efficiency of the fixed motifs to fine tune expression of the downstream protein coding region. false false _437_ 0 3073 9 It's complicated false The part was designed using primers that introduced standard 20 bp primer binding sites flanking the upstream and downstream regions of the part. false Matthew Orton BBa_K319019_sequence 1 cctctcctttttgaaatattatgcagaggttgcgcggcgtgcactgggcgcggggcaggtataaaggtgggtggtttggggtgtgtggaattgtgtgcggataacaatttcacacaacgtagggggcgaacggcgagattaaaagtatcaacaaaaaatgatggtggttggtttgtgtggaaagaaatgcgagccatgtttccggatctatcccgccgccaccatggag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z