BBa_K321003 1 BBa_K321003 intracellular chain of CD3 zeta 2010-10-24T11:00:00Z 2015-05-08T01:11:59Z Cloned from the human genome. Encodes the intracellular signaling domain of the CD3 zeta molecule of the T-Cell Receptor complex. The sequence encodes the three ITAMs (Immunoreceptor tyrosine-based activation motif) that can activate immune cells. false false _445_ 0 2764 9 It's complicated false N/A false Crystal Liu annotation2101174 1 ITAM2 range2101174 1 145 228 annotation2101162 1 ITAM1 range2101162 1 28 114 annotation2101176 1 CD3 zeta intracellular range2101176 1 1 336 annotation2101175 1 ITAM3 range2101175 1 235 321 BBa_K321003_sequence 1 agagtgaagttcagcaggagcgcagacgcccccgcgtaccagcagggccagaaccagctctataacgagctcaatctaggacgaagagaggagtacgatgttttggacaagagacgtggccgggaccctgagatggggggaaagccgagaaggaagaaccctcaggaaggcctgtacaatgaactacagaaagataagatggcggaggcctacagtgagattgggatgaaaggcgagcgccggaggggcaaggggcacgatggcctttaccagggtctcagtacagccaccaaggacacctacgacgcccttcacatgcaggccctgccccctcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z