BBa_K321004 1 BBa_K321004 intracellular chain of KIR3DL1 2010-10-24T11:00:00Z 2015-05-08T01:11:59Z Cloned from the human genome. Encodes the intracellular signaling chain of the KIR3DL1 immune receptor. Inhibits immune cell activation via the ITIM (immunoreceptor tyrosine-based inhibition motif) motif. false false _445_ 0 2764 9 It's complicated true A pre-existing PstI site was removed to meet the BioBrick standard. false Hannah Yan annotation2101182 1 ITIM1 range2101182 1 94 111 annotation2101183 1 ITIM2 range2101183 1 184 201 annotation2101181 1 KIR3DL1 intracellular domain range2101181 1 1 240 BBa_K321004_sequence 1 tccaacaaaaaaaatgctgctgtaatggaccaagagcctccagggaacagaacagccaacagcgaggactctgatgaacaagaccctgaggaggtgacatacgcacagttggatcactgcgttttcacacagagaaaaatcactcgcccttctcagaggcccaagacaccccctacagataccatcttgtacacggaacttccaaatgctaagcccagatccaaagttgtctcctgccca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z