BBa_K322007 1 BBa_K322007 Lumazine protein (LumP). Causes blue shift of <i>P. phosphoreum</i> luciferase emmision spectrum. 2010-09-25T11:00:00Z 2015-05-08T01:11:59Z Source: genomic DNA of Photobacterium phosphoreum. This is the lumazine protein of Photobacterium phosphoreum. Lumazine protein (LumP) of Photobacterium phosphoreum is a small protein which binds a fluorescent pteridine, 6,7-dimethyl-8-(1'-D-ribityl)lumazine, as cofactor. In P. phosphoreum, it acts to shift the wavelength of light emitted by luciferase, LuxAB, from 495 nm to a shorter wavelength, around 475 nm (O'Kane et al, 1990 and references cited therein). false false _441_ 0 6225 9 It's complicated true We submitted a version of lumP last year (BBa_K216007), but made a new one since we were having some issues working with our clone (lots of red colonies). So we made a new one in pSB1C3 starting from the original PCR product. On sequencing this (as well as looking at the sequence results from the original plasmids, M1117 and M1118) it was found that the sequence differed from the one we had submitted in a number of mutations, some silent, some not. false Chris French and Maria Kowal annotation2083463 1 lumP range2083463 1 10 578 annotation2083462 1 rbs range2083462 1 1 9 BBa_K322007_sequence 1 gagattattatgttcaaaggtatagttcagggcactggaataattaaaaaaatatcaaaaaatgatgatacccaaagacatggcattacttttccaaaaaatatattggacttagttgcaaaagatactgtcatgctcgtaaatggatgctcattaactgttgttcgcatcacaggtgatgtcgtttatttcgatatagatcaggcacttaataccacaacctttgattcattagaaatcggtgacaaggtaaacttagaactacgtccagaatttggctcactccttgggaaaggtgctttaactggaaatataaagggggtagctactgttgataatattactgaagaagaagatcttcttaaagtttatattgaaattcctaaaaacctaaccaaaaatatttccgcagaagatcatattggaattaatggtgtatctaattctattgaagaagtttccaatgatattatttgcattaattatcccaaaaatttatctattaccaccaaccttagcactttagaagcaggttcgaaggttaacgtagaaacattaaatgtatcaaatgaatggtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z