BBa_K322115 1 BBa_K322115 phoA promoter 2010-10-26T11:00:00Z 2015-05-08T01:11:59Z phoA: Escherichia coli K12 This part is the upstream region (150 bases) of E. coli phoA. In the green light sensor system, it is used to activate the expression of downstream parts. It is also regulated by the PhoR-PhoB two component system. false false _441_ 0 6225 9 Not in stock false The 150 bases upstream of the phoA gene were amplified to include the promoter. false Meng Lu and William Rostain BBa_K322115_sequence 1 gacgatacggagctgctgcgcgattacgtaaagaagttattgaagcatcctcgtcagtaaaaagttaatcttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttgtttttattttttaatgtatttgtacatggagaaaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z