BBa_K322117 1 BBa_K322117 phoA promoter and lacZ reporter 2010-10-26T11:00:00Z 2015-05-08T01:11:59Z phoA promoter: Escherichia coli K12 lacZ reporter: Escherichia coli K12 This biobrick regulated by the PhoR-PhoB two component system. This part can thus be used test the green light sensor in a "Coliroid" fashion, when grown with Xgal. false false _441_ 0 6225 9 Not in stock false no false William Rostain and Meng Lu component2109213 1 BBa_K322115 component2109216 1 BBa_J33202 annotation2109213 1 BBa_K322115 range2109213 1 1 160 annotation2109216 1 BBa_J33202 range2109216 1 169 411 BBa_K322115 1 BBa_K322115 phoA promoter 2010-10-26T11:00:00Z 2015-05-08T01:11:59Z phoA: Escherichia coli K12 This part is the upstream region (150 bases) of E. coli phoA. In the green light sensor system, it is used to activate the expression of downstream parts. It is also regulated by the PhoR-PhoB two component system. false false _441_ 0 6225 9 Not in stock false The 150 bases upstream of the phoA gene were amplified to include the promoter. false Meng Lu and William Rostain BBa_J33202 1 BBa_J33202 lacZ 2006-10-12T11:00:00Z 2015-08-31T04:08:46Z The DNA was derived by PCR from E. coli BL21, which possesses an intact lacZ gene. Primers were designed based on sequence from GenBank accession J01636, GI:146575. A stop codon was artificially introduced to replace codon 78. The sequence reported here is derived by sequencing of the Biobrick construct. Released HQ 2013 This gene encodes the N-terminal 77 amino acid residues of LacZ. When expressed in an E. coli host carrying the lacZ-delta-M15 mutation, common in laboratory strains, it complements the delection resulting in the production of active LacZ, which can be detected by various means, including chromogenic substrates such as Xgal (5-bromo-4-chloro-3-indolyl-beta-D-galactoside) and ONPG (o-nitrophenyl galactoside). false false _63_ 0 837 63 In stock true Note that a stop codon was introduced to replace codon 78 of lacZ, resulting in production only of the N-terminal 77 amino acid residues of LacZ. This is sufficient to complement the lacZ-delta-M15 mutation commonly found in laboratory strains of E. col used for alpha-complementation. false Chris French annotation1902819 1 lacZ' range1902819 1 13 243 annotation1902818 1 rbs range1902818 1 1 4 BBa_J33202_sequence 1 gaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K322117_sequence 1 gacgatacggagctgctgcgcgattacgtaaagaagttattgaagcatcctcgtcagtaaaaagttaatcttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttgtttttattttttaatgtatttgtacatggagaaaataaatactagaggaggaaacagctatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtga BBa_K322115_sequence 1 gacgatacggagctgctgcgcgattacgtaaagaagttattgaagcatcctcgtcagtaaaaagttaatcttttcaacagctgtcataaagttgtcacggccgagacttatagtcgctttgtttttattttttaatgtatttgtacatggagaaaataaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z