BBa_K322210 1 BBa_K322210 Chloramphenicol acetyltransferase (cat) 2010-09-24T11:00:00Z 2015-05-08T01:11:59Z Source: plasmid pTG262 (broad host range vector for Gram positive and Gram negative bacteria). cat is an antibiotic resistance gene, used in the first step of BRIDGE which requires the deletion of existing DNA (probably a non-coding piece or a non-essential gene) to select for cells which have taken up the construct by growing them on the relevant antibiotic. In the BRIDGE, With this system, the markers are removed every time you insert a new gene, so they can be used again and again indefinitely. You could essentially replace the entire genome with new genes. Notes: has complete suffix but prefix lacks NotI site. Features: coding sequence runs from base 294 to 944, rbs 280 to 285. false false _441_ 0 6225 9 It's complicated true Notes: The PCR product, P1601, was initially cloned in pSB1A2, which made it easy to confirm that the gene was active, since the transformants became chloramphenicol resistant. A considerable amount of upstream DNA was included in the hope that this would include the promoter region. In the course of the iGEM project, the same PCR product was cloned in pSB1C3 to comply with new submission rules. Since this BioBrick was originally prepared for internal use, it uses abbreviated forms of the prefix and suffix lacking the NotI sites, but is in all ways compatible with RFC10 assembly. false Geraldine Avila annotation2083599 1 cat range2083599 1 294 944 annotation2083598 1 RBS range2083598 1 280 285 BBa_K322210_sequence 1 tctatcccggcaatagttacccttattatcaagataagaaagaaaaggatttttcgctacgctcaaatcctttaaaaaaacacaaaagaccacattttttaatgtggtctttattcttcaactaaagcacccattagttcaacaaacgaaaattggataaagtgggatatttttaaaatatatatttatgttacagtaatattgacttttaaaaaaggattgattctaatgaagaaagcagacaagtaagcctcctaaattcactttagataaaaatttaggaggcatatcaaatgaactttaataaaattgatttagacaattggaagagaaaagagatatttaatcattatttgaaccaacaaacgacttttagtataaccacagaaattgatattagtgttttataccgaaacataaaacaagaaggatataaattttaccctgcatttattttcttagtgacaagggtgataaactcaaatacagcttttagaactggttacaatagcgacggagagttaggttattgggataagttagagccactttatacaatttttgatggtgtatctaaaacattctctggtatttggactcctgtaaagaatgacttcaaagagttttatgatttatacctttctgatgtagagaaatataatggttcggggaaattgtttcccaaaacacctatacctgaaaatgctttttctctttctattattccatggacttcatttactgggtttaacttaaatatcaataataatagtaattaccttctacccattattacagcaggaaaattcattaataaaggtaattcaatatatttaccgctatctttacaggtacatcattctgtttgtgatggttatcatgcaggattgtttatgaactctattcaggaattgtcagataggcctaatgactggcttttataatatgagataatgccgactgtactttttacagtcggttttctaaaacgatacattaataggtacgaaaaagcaactttttttgcgcttaaaaccagtcataccaataacttaagggtaactagcctcgccggaaagag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z