BBa_K322705 1 BBa_K322705 E. coli TnaA (tryptophanase) upstream region (500bp) 2010-09-25T11:00:00Z 2015-05-08T01:12:00Z E. coli tnaA It is to be used for targeting genes to this locus in BRIDGE. In the BRIDGE, with this system, the markers are removed every time you insert a new gene, so they can be used again and again indefinitely. You could essentially replace the entire genome with new genes. false false _441_ 0 6225 9 Not in stock false Sequence results: good PCR products have been obtained. false Chris French and Richard Edward Partridge-Hicks BBa_K322705_sequence 1 atgcggcttcgcttcattgttaccactcctgttattcctcaaccctttttttaaacattaaaattcttacgtaatttataatctttaaaaaaagcatttaatattgctccccgaacgattgtgattcgattcacatttaaacaatttcagaatagacaaaaactctgagtgtaataatgtagcctcgtgtcttgcgaggataagtgcattatgaatatcttacatatatgtgtgacctcaaaatggttcaatattgacaacaaaattgtcgatcaccgcccttgatttgcccttctgtagccatcaccagagccaaaccgattagattcaatgtgatctatttgtttgctatatcttaattttgccttttgcaaaggtcatctctcgtttatttacttgttttagtaaatgatggtgcttgcatatatatctggcgaattaatcggtatagcagatgtaatattcacagggatcactg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z