BBa_K323039 1 BBa_K323039 Protein assembly DNA program 2010-10-19T11:00:00Z 2015-05-08T01:12:00Z a a false false _443_ 0 6971 9 In stock true a false Jernej Turn??ek annotation2101344 1 ZNF_HIVC_O range2101344 1 56 64 annotation2101341 1 Blues_O range2101341 1 23 31 annotation2101340 1 Jazz_O range2101340 1 12 19 annotation2101345 1 Gli1_O range2101345 1 67 81 annotation2101339 1 Tyr_O range2101339 1 1 8 annotation2101343 1 PBSII_O range2101343 1 45 53 annotation2101342 1 Zif268_O range2101342 1 34 42 BBa_K323039_sequence 1 gaaggggaattgctgctgcggtgtttggatggagcgtgggcggggtgtggaaattgatgctgcattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z