BBa_K323043 1 BBa_K323043 DNA program 12346 2010-10-19T11:00:00Z 2015-05-08T01:12:00Z a a false true _443_ 0 6971 9 It's complicated false a false Jernej Turn??ek annotation2101316 1 Gli1_O range2101316 1 45 58 annotation2101236 1 Blues_O range2101236 1 12 19 annotation2101296 1 PBSII_O range2101296 1 34 42 annotation2101275 1 Zif268_O range2101275 1 23 31 annotation2101235 1 Jazz_O range2101235 1 1 8 BBa_K323043_sequence 1 gctgctgcggtgtttggatggagcgtgggcggggtgtggaaattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z