BBa_K323066 1 BBa_K323066 DNA program 2010-10-19T11:00:00Z 2015-05-08T01:12:01Z a a false true _443_ 0 7571 9 It's complicated true a false Jernej Turn??ek annotation2101230 1 Blues_O range2101230 1 12 19 annotation2101229 1 Jazz_O range2101229 1 1 8 annotation2101233 1 ZNF_HIVC_O range2101233 1 45 53 annotation2101234 1 Gli1_O range2101234 1 56 69 annotation2101231 1 Zif268_O range2101231 1 23 31 annotation2101232 1 PBSII_O range2101232 1 34 42 BBa_K323066_sequence 1 gctgctgcggtgtttggatggagcgtgggcggggtgtggaaattgatgctgcattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z