BBa_K323152 1 BBa_K323152 DNA Program 12346 2010-10-24T11:00:00Z 2015-05-08T01:12:02Z a a false false _443_ 0 6971 9 It's complicated false a false Tina Ilc annotation2107856 1 Zif268_O range2107856 1 23 31 annotation2107858 1 Gli1_O range2107858 1 45 58 annotation2107854 1 Jazz_O range2107854 1 1 8 annotation2107855 1 Blues_O range2107855 1 12 19 annotation2107859 1 BBa_K323043 range2107859 1 1 59 annotation2107857 1 PBSII_O range2107857 1 34 42 BBa_K323152_sequence 1 gctgctgcggtgtttggatggagcgtgggcggggtgtggaaattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z