BBa_K323153 1 BBa_K323153 Scrambled DNA program 2010-10-24T11:00:00Z 2015-05-08T01:12:02Z a a false false _443_ 0 6971 9 It's complicated false a false Tina Ilc annotation2107878 1 Zif268 range2107878 1 1 8 annotation2107882 1 Znf_HivC range2107882 1 44 52 annotation2107880 1 Jazz range2107880 1 22 30 annotation2107883 1 Gli1 range2107883 1 54 69 annotation2107881 1 Blues range2107881 1 33 41 annotation2107879 1 PBSII range2107879 1 11 19 BBa_K323153_sequence 1 gcgtgggcggggtgtggaaattgctgctgcggtgtttggatggagatgctgcattgaccacccaagacga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z