BBa_J13002 1 BBa_J13002 TetR repressed POPS/RIPS generator 2005-06-15T11:00:00Z 2015-08-31T04:08:29Z Released HQ 2013 -- No description -- false true _37_5_ 0 88 37 In stock false true Jeff Tabor component1535786 1 BBa_B0034 component1535778 1 BBa_R0040 annotation1535786 1 BBa_B0034 range1535786 1 63 74 annotation1535778 1 BBa_R0040 range1535778 1 1 54 BBa_K324003 1 BBa_K324003 TetR repressible generator of LacI 2010-10-24T11:00:00Z 2015-05-08T01:12:02Z A simple Biobrick assembly was conducted to join the TetR promoter+RBS (BBa_J13002) with LacI (BBa_K324000). J13002 was obtained from the 2010 Spring Distribution, while K324000 was adapted by 2010 Brown iGEM from an existing part. See the part's page for further details http://partsregistry.org/Part:BBa_J13002 http://partsregistry.org/Part:BBa_K324000 This part combines two biobricks, a TetR repressible promoter+RBS (BBa_J13002) and the LacI regulatory protein in RFC25 assembly (BBa_K324000). This BioBrick allows the expression of LacI when inserted into E. coli, for the purpose of testing constructs controlled by the LacI promoter. false false _444_ 0 6047 9 It's complicated false These parts were joined together with standard biobrick assembly, even though the LacI protein was in RFC25 and thus capable of protein fusion assembly as well. false Julius Ho component2100711 1 BBa_J13002 component2100713 1 BBa_K324000 annotation2100711 1 BBa_J13002 range2100711 1 1 74 annotation2100713 1 BBa_K324000 range2100713 1 81 1184 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 annotation1986785 1 -35 range1986785 1 20 25 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K324000 1 BBa_K324000 LacI repressor protein in RFC25 format 2010-10-24T11:00:00Z 2015-05-08T01:12:02Z http://partsregistry.org/Part:BBa_I732100 Submitted by the USTC '07 iGEM team, taken from the 2010 Spring Distribution This part consists of the lacI repressor protein (BBa_I732100) optimized with endings for protein fusion in the Freiburg assembly format (RFC25). There is also a 6-his tag appended to the C-terminus for easy purification using Ni-affinity column. RFC 25 prefix/suffix and 6-his sequences attached via PCR. false false _444_ 0 6047 9 It's complicated true 6-his tag was appended to the 3' end of this protein to allow for purification upon expression in E. coli. We chose a C-terminal tag to avoid isolation of incompletely translated peptides. false Julius Ho annotation2100737 1 double stop codon range2100737 1 1098 1104 annotation2100688 1 LacI in RFC25 range2100688 1 1 1104 BBa_J13002_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K324000_sequence 1 atgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagcatcatcatcatcatcattaataa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K324003_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaccagtaacgttatacgatgtcgcagagtatgccggtgtctcttatcagaccgtttcccgcgtggtgaaccaggccagccacgtttctgcgaaaacgcgggaaaaagtggaagcggcgatggcggagctgaattacattcccaaccgcgtggcacaacaactggcgggcaaacagtcgttgctgattggcgttgccacctccagtctggccctgcacgcgccgtcgcaaattgtcgcggcgattaaatctcgcgccgatcaactgggtgccagcgtggtggtgtcgatggtagaacgaagcggcgtcgaagcctgtaaagcggcggtgcacaatcttctcgcgcaacgcgtcagtgggctgatcattaactatccgctggatgaccaggatgccattgctgtggaagctgcctgcactaatgttccggcgttatttcttgatgtctctgaccagacacccatcaacagtattattttctcccatgaagacggtacgcgactgggcgtggagcatctggtcgcattgggtcaccagcaaatcgcgctgttagcgggcccattaagttctgtctcggcgcgtctgcgtctggctggctggcataaatatctcactcgcaatcaaattcagccgatagcggaacgggaaggcgactggagtgccatgtccggttttcaacaaaccatgcaaatgctgaatgagggcatcgttcccactgcgatgctggttgccaacgatcagatggcgctgggcgcaatgcgcgccattaccgagtccgggctgcgcgttggtgcggatatctcggtagtgggatacgacgataccgaagacagctcatgttatatcccgccgttaaccaccatcaaacaggattttcgcctgctggggcaaaccagcgtggaccgcttgctgcaactctctcagggccaggcggtgaagggcaatcagctgttgcccgtctcactggtgaaaagaaaaaccaccctggcgcccaatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagcatcatcatcatcatcattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z