BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K327002 1 BBa_K327002 Polycistronic Delta, Tet, and 434 cI 2010-08-04T11:00:00Z 2015-05-08T01:12:03Z Registry This part is 434, tet, and delta co-expressed; it is a useful intermediate for the construction of our device. false false _447_ 0 6138 415 Not in stock false N/A false Keegan Owsley component2268404 1 BBa_B0034 component2268426 1 BBa_B0015 component2268413 1 BBa_I746352 component2268419 1 BBa_C0040 component2268406 1 BBa_C0052 component2268415 1 BBa_B0034 annotation2268404 1 BBa_B0034 range2268404 1 1 12 annotation2268413 1 BBa_I746352 range2268413 1 721 984 annotation2268426 1 BBa_B0015 range2268426 1 1704 1832 annotation2268419 1 BBa_C0040 range2268419 1 1011 1695 annotation2268406 1 BBa_C0052 range2268406 1 19 687 annotation2268415 1 BBa_B0034 range2268415 1 993 1004 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_I746352 1 BBa_I746352 delta activator from phiR73 phage 2007-09-11T11:00:00Z 2015-08-31T04:08:04Z plasmid DNA supplied by Prof. Richard Calendar, University of California. The delta activator taken from phiR73 phage acts on a class of inducible promoters (parts I746360 to I746365), inducing their activity to varying degrees. The part sequence does already contain a ribosome binding site (B0034)! false false _116_ 0 2122 9 In stock true The part does contain a RBS (B0034) already. true Stefan Milde annotation1943873 1 phiR73 delta range1943873 1 22 22 annotation1943872 1 phiR73 delta range1943872 1 22 264 annotation1943871 1 B0034 range1943871 1 1 12 annotation1943874 1 silent mutation to remove PstI site range1943874 1 102 102 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_C0040 1 tetR tetracycline repressor from transposon Tn10 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999) Released HQ 2013 Coding region for the TetR protein without the Ribosome Binding Site. Modified with an LVA tail for rapid degradation of the protein and faster fall time for the emission. TetR binds to the pTet regulator (BBa_R0040). aTc (anhydrotetracycline) binds to TetR and inhibits its operation.</P> false true _1_ 0 24 7 In stock false References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P> References (unparsed) here: <p>Elowitz, M. B. Transport, Assembly, and Dynamics in Systems of Interacting Proteins. Thesis, Princeton Univ., Princeton (1999). </P> <p> Lutz R, Bujard H., Independent and tight regulation of transcriptional units in Escherichia coli via the LacR/O, the TetR/O and AraC/I1-I2 regulatory elements. Nucleic Acids Res. 1997 Mar 15;25(6):1203-10. PMID: 9092630 </p> <P>BBa_C0040 TetR Protein is based on the TetR sequence from Elowitz's repressilator. It has been modified to include a rapid degradation LVA tail, and includes the BioBrick standard assembly head and tail restriction sites. The RBS has been removed. The stop codon has been changed from TAA to a double stop codon TAATAA. <P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman. annotation23329 1 tetR range23329 1 4 620 annotation23330 1 SsrA range23330 1 621 654 annotation2213989 1 Help:Barcodes range2213989 1 661 685 BBa_C0052 1 cI 434 cI repressor from phage 434 (+LVA) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z Bacteriophage 434 Released HQ 2013 The 434 cI repressor protein coding sequence is a 710 base-pair sequence with the standard RBS-compatible BioBrick prefix and the standard BioBrick suffix sections on its ends. It binds to the 434 regulatory sequence, BBa_R0052. The sequence contains a LVA tag for faster degredation and has no RBS.</p> false false _1_ 0 24 7 In stock false References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P> References (unparsed) here: <p>Nikolnikov,S., Posfai,G. and Sain,B. <em>The construction of a versatile plasmid vector that allows direct<br> selection of fragments cloned into six unique sites of the cI gene of coliphage 434</em>. Gene 30 (1-3), 261-265 (1984)<P><P> true Maia Mahoney annotation7035 1 BBa_C0052 range7035 1 1 669 annotation1745 1 LVA range1745 1 631 669 annotation1743 1 cI 434 range1743 1 1 669 annotation2213992 1 Help:Barcodes range2213992 1 670 694 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation1687 1 stop range1687 1 34 34 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_B0034_sequence 1 aaagaggagaaa BBa_C0040_sequence 1 atgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcac BBa_K327002_sequence 1 aaagaggagaaatactagatgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctctactagagaaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaatactagagaaagaggagaaatactagatgtccagattagataaaagtaaagtgattaacagcgcattagagctgcttaatgaggtcggaatcgaaggtttaacaacccgtaaactcgcccagaagctaggtgtagagcagcctacattgtattggcatgtaaaaaataagcgggctttgctcgacgccttagccattgagatgttagataggcaccatactcacttttgccctttagaaggggaaagctggcaagattttttacgtaataacgctaaaagttttagatgtgctttactaagtcatcgcgatggagcaaaagtacatttaggtacacggcctacagaaaaacagtatgaaactctcgaaaatcaattagcctttttatgccaacaaggtttttcactagagaatgcattatatgcactcagcgctgtggggcattttactttaggttgcgtattggaagatcaagagcatcaagtcgctaaagaagaaagggaaacacctactactgatagtatgccgccattattacgacaagctatcgaattatttgatcaccaaggtgcagagccagccttcttattcggccttgaattgatcatatgcggattagaaaaacaacttaaatgtgaaagtgggtccgctgcaaacgacgaaaactacgctttagtagcttaataacactgatagtgctagtgtagatcactactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_C0052_sequence 1 atgagtatttcttccagggtaaaaagcaaaagaatccagcttggacttaaccaggctgaacttgctcaaaaggtggggactacccagcagtctatagagcagctcgaaaacggtaaaactaagcgaccacgctttttaccagaacttgcgtcagctcttggcgtaagtgttgactggctgctcaatggcacctctgattcgaatgttagatttgttgggcacgttgagcccaaagggaaatatccattgattagcatggttagagctggttcgtggtgtgaagcttgtgaaccctacgatatcaaggacattgatgaatggtatgacagtgacgttaacttattaggcaatggattctggctgaaggttgaaggtgattccatgacctcacctgtaggtcaaagcatccctgaaggtcatatggtgttagtagatactggacgggagccagtgaatggaagccttgttgtagccaaactgactgacgcgaacgaagcaacattcaagaaactggtcatagatggcggtcagaagtacctgaaaggcctgaatccttcatggcctatgactcctatcaacggaaactgcaagattatcggtgttgtcgtggaagcgagggtaaaattcgtagctgcaaacgacgaaaactacgctttagtagcttaataactctgatagtgctagtgtagatctc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_I746352_sequence 1 aaagaggagaaatactagatgatgcgctgccctttctgtcgtcattcagcgcatacccgcaccagccggtatgtgagtgacaatgtcaaagaaagttatctccagtgccagaatatttactgttcggcgacatttaaaacgcatgagtcaatttgtgccgtgattcgttctccggtcacggaggaaaaaccagcaccggcaagcacagcaccggctgttgtccgaaaagttaaaggctgttacagctcaccattcaaccattaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z