BBa_K328003 1 BBa_K328003 cspA Cold box + UTR + SD +DB 2010-10-25T11:00:00Z 2015-05-08T01:12:03Z PCR E coli dh5a This sequence takes the UTR Region of cspA and the DB sequence to test it about its function with other promoters after a cold shock false false _450_ 0 1992 9 It's complicated true This is was to measure which part was essential on a Cold Shock response false MEXICO UNAM CINVESTAV IRA BBa_K328003_sequence 1 ggtttgacgtacagaccattaaagcagtgtagtaaggcaagtcccttcaagagttatcgttgatacccctcgtagtgcacattcctttaacgcttcaaaatctgtaaagcacgccatatcgccgaaaggcacacttaattattaaaggtaatacactatgtccggtaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z