BBa_K328004 1 BBa_K328004 cspA Cold box + UTR + SD 2010-10-25T11:00:00Z 2015-05-08T01:12:03Z PCR E coli dh5a cspA UTR to DB sequence used to measure the activity with other promoters rather than cspA promoter false false _450_ 0 1992 9 It's complicated false Used to test with different promoters false MEXICO UNAM CINVESTAV IRA BBa_K328004_sequence 1 gaccattaaagcagtgtagtaaggcaagtcccttcaagagttatcgttgatacccctcgtagtgcacattcctttaacgcttcaaaatctgtaaagcacgccatatcgccgaaaggcacacttaattattaaaggtaatacactatgtccggtaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z