BBa_I732006 1 lacZ-alpha lacZ alpha fragment 2007-07-06T11:00:00Z 2015-08-31T04:07:56Z PCR amplified from BBa_J33202 without the RBS. Released HQ 2013 In strains with lacZ-omega (lacZ N-terminal deletion mutant) like DH5alpha, DH10B and Top10, lacZ-alpha restores the beta-galactosidase activity. false true _156_ 0 1557 9 In stock false None true Zhan Jian annotation1936904 1 lacZ range1936904 1 1 234 annotation1936906 1 STOP range1936906 1 229 234 annotation1936905 1 START range1936905 1 1 3 BBa_B0031 1 BBa_B0031 RBS.2 (weak) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Medium RBS based on Ron Weiss thesis. Strength considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0032</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false <P> <P>Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-1&quot; in figure 4-14 of thesis). <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Cho</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23316 1 conserved range23316 1 7 10 BBa_K329006 1 BBa_K329006 Weak RBS (B0031) - LacZ alpha fragment (I732006) 2010-10-11T11:00:00Z 2015-05-08T01:12:03Z 2010 Distribution kit LacZ-alpha fragment (<partinfo>BBa_I732006</partinfo>) with a Weak RBS upstream (<partinfo>BBa_B0031</partinfo>). In strains with LacZ-omega (LacZ N-terminal deletion mutants) like DH5alpha, DH10B and Top10, LacZ-alpha restores the beta-galactosidase activity. <br>We have also designed the same construct with a Strong RBS (<partinfo>BBa_K329005</partinfo>). false false _449_ 0 7402 9 It's complicated false We used BioBrick Standard Assembly. false Raphael Pantier component2085659 1 BBa_B0031 component2085663 1 BBa_I732006 annotation2085663 1 BBa_I732006 range2085663 1 21 254 annotation2085659 1 BBa_B0031 range2085659 1 1 14 BBa_K329006_sequence 1 tcacacaggaaacctactagatgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa BBa_B0031_sequence 1 tcacacaggaaacc BBa_I732006_sequence 1 atgaccatgattacggattcactggccgtcgttttacaacgtcgtgactgggaaaaccctggcgttacccaacttaatcgccttgcagcacatccccctttcgccagctggcgtaatagcgaagaggcccgcaccgatcgcccttcccaacagttgcgcagcctgaatggcgaatggcgctttgcctggtttccggcaccagaagcggtgccggaaagctggctggagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z