BBa_K330001 1 slipper Protein secretor in Lactobacillus Plantarum 2010-10-06T11:00:00Z 2015-05-08T01:12:04Z The sequence of Signal Peptide lp_0297 came from the genome of Lactobicillus Plantarum WCFS1. The gene sequence of Flag-tag is artificially designed according to its peptide sequence. The sequence consists of signal peptide gene lp_0297, Flag-tag sequence, and two enzyme cutting sites (NdeI and HindIII). Bacteria use several pathways for protein export to the membrane, the cell wall or the medium. Many proteins follow the Sec-dependent pathway and are synthesized as precursors with an N-terminal signal peptide that directs the protein to the Sec translocation machinery. Here the signal peptide lp_0297 can help to drive the protein added after it to be secreted out of Lactobacillus Plantarum, and the signal peptide itself will be cleaved off during or shortly after the translocation.The flag-tag added is for the convenience of detection. The two enzyme cutting sites are designed for adding the sequence of proteins to be secreted. We can also choose SpeI and PstI sites to add protein sequence. Reference: Genome-wide analysis of signal peptide functionality in Lactobacillus plantarum WCFS1(Geir Mathiesen*1, Anita Sveen1, May Bente Brurberg2, Lasse Fredriksen1, Lars Axelsson3 and Vincent GH Eijsink1). false false _448_ 0 6417 9 It's complicated true 18bp before start codon are chosen as RBS. The original start codon of Signal Peptide lp_0297 is "gtg", which has not been changed to "atg" while making it into our part. The sequence between NdeI and HindIII is randomly chosen as "ttgata". false XIE Chensu annotation2083458 1 Flag-tag range2083458 1 106 129 annotation2083062 1 rbs range2083062 1 1 18 annotation2083456 1 start range2083456 1 19 21 annotation2083457 1 Signal Peptide lp_0297 range2083457 1 19 105 BBa_K330001_sequence 1 tgatgggagcgacgttaggtgaaagaagtaaggttttggggactcttgttaggactgtttgtctgtttaggggcagtgataccgttagttagtaaggctgacgtagactacaaagacgatgacgataaacatatgttgataaagctt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z