BBa_K331007 1 BBa_K331007 Beta-lactamase Bla Signal Sequence 2010-06-27T11:00:00Z 2015-05-08T01:12:04Z http://www.ncbi.nlm.nih.gov/protein/YP_001267868.1 This protein is isolated from Pseudomonas putida and catalyzes the conversion of catechol to cis,cis-muconic acid which is further broken down and utilized by the cell. false false _463_ 0 4444 9 Not in stock false None false Lisza Bruder BBa_K331007_sequence 1 atgagcattcagcattttcgtgtggcgctgattccgttttttgcggcgttttgcctgccggtgtttgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z