BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K331002 1 BBa_K331002 ECFP with C-terminal Arginine Tag 2010-06-27T11:00:00Z 2015-05-08T01:12:04Z The idea came from: Seebeck, F. P., Woycechowsky, K. J., Zhuang, W., Rabe, J. P., and Hilvert, D., (2006). A simple tagging system for protein encapulation. J. Am. Chem. Soc. 128, 4516-4517 This protein is the ECFP fused with the C-terminal Arginine tag found in BBa_K249005. It is designed to be part of a construct for targeting into the lumazine synthase microcompatment (BBa_K331000) false false _463_ 0 4444 9 Not in stock false none false Lisza Bruder annotation2071686 1 stop range2071686 1 754 756 annotation2071685 1 start range2071685 1 1 3 annotation2071687 1 Arginine Tag range2071687 1 725 753 BBa_K331025 1 BBa_K331025 RBS with C-terminal Oligo Arginine - ECFP Fusion 2010-09-28T11:00:00Z 2015-05-08T01:12:04Z This sequence was synthesized by Gene Art This part has a oligo arginine sequence fused to the C-terminus of an enhanced cyan fluorescent protein. This will be a component of the proof-of-concept part <partinfo>BBa_K331019</partinfo> which will show localization of proteins into the interior of a microcompartment formed by the assemly of lumazine synthase proteins. false false _463_ 0 6831 9 It's complicated false We chose not to include a transcriptional promoter to this part because we wanted the freedom to put it under the control of varied promoters. We also chose not to include a transcriptional terminator to this part because we planned to use it in an operon, where we would be expressing multiple proteins from a single transcript. false Adam Smith component2081119 1 BBa_B0034 component2081123 1 BBa_K331002 annotation2081119 1 BBa_B0034 range2081119 1 1 12 annotation2081123 1 BBa_K331002 range2081123 1 19 774 BBa_K331002_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagcactagagccgccgccgccgccgccgccgccgccgctaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K331025_sequence 1 aaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagcactagagccgccgccgccgccgccgccgccgccgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z