BBa_K331029 1 BBa_K331029 Lac Inducible C-terminal Arg Tagged ECFP (no terminator) 2010-10-06T11:00:00Z 2015-05-08T01:12:05Z To come... This is <partinfo>BBa_K331025</partinfo> with the lac promoter <partinfo>BBa_R0010</partinfo> added in front. false false _463_ 0 6831 9 Not in stock false To come... false Adam Smith component2083719 1 BBa_B0034 component2083711 1 BBa_R0010 component2083723 1 BBa_K331002 annotation2083711 1 BBa_R0010 range2083711 1 1 200 annotation2083723 1 BBa_K331002 range2083723 1 227 982 annotation2083719 1 BBa_B0034 range2083719 1 209 220 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K331002 1 BBa_K331002 ECFP with C-terminal Arginine Tag 2010-06-27T11:00:00Z 2015-05-08T01:12:04Z The idea came from: Seebeck, F. P., Woycechowsky, K. J., Zhuang, W., Rabe, J. P., and Hilvert, D., (2006). A simple tagging system for protein encapulation. J. Am. Chem. Soc. 128, 4516-4517 This protein is the ECFP fused with the C-terminal Arginine tag found in BBa_K249005. It is designed to be part of a construct for targeting into the lumazine synthase microcompatment (BBa_K331000) false false _463_ 0 4444 9 Not in stock false none false Lisza Bruder annotation2071686 1 stop range2071686 1 754 756 annotation2071685 1 start range2071685 1 1 3 annotation2071687 1 Arginine Tag range2071687 1 725 753 BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961227 1 start range1961227 1 173 173 annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_K331002_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagcactagagccgccgccgccgccgccgccgccgccgctaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K331029_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtgaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccctgacctggggcgtgcagtgcttcagccgctaccccgaccacatgaagcagcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacatcagccacaacgtctatatcaccgccgacaagcagaagaacggcatcaaggccaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagcacccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagcactagagccgccgccgccgccgccgccgccgccgctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z