BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K332021 1 BBa_K332021 Ptet + RBS + LuxR 2010-10-23T11:00:00Z 2015-05-08T01:12:05Z 1. LuxI protein (BBa_C0061) is the synthase that converts S-adenosylmethionine (SAM) into acyl-homoserine lactone (AHL). When the concentration of AHL reaches a threshold level, it binds to the N-terminal domain of a LuxR protein. Then the LuxR/AHL complex binds the Lux box within PtetR promoter (BBa_C0040), which then activates suicidal gene expression. 2. LuxR (BBa_C0062) is transcribed continuously by the constitutive promoter (BBa_J23106), and later works in conjunction with AHL. This design can control the concentration of LuxR protein in a steady phase, and the concentration of AHL/LuxR complex is only affected by the concentration of LuxI protein (BBa_C0061). Released HQ 2013 In this portion of the design, we aim to achieve population control by combining a cell-signaling system (luxR/luxI) and suicidal gene for controlling the number of E.coli. The population controlling function in the engineered E.coli can warn us of high-density E. coli congregations by emitting fluorescent proteins. Green fluorescent light means the Cry circuit is functional and the population density is under control, while red fluorescent gene signals E.coli overpopulation. false false _452_ 0 7483 9 In stock false (I) Strand C (BBa_ K332021) 1. Strand C is synthesized from three fragments ??? (1) Ptet (2) RBS+LuxR (3) RBS+LuxI+double ter sites. 2. All of them are in the form of plasmids, so we digest them by appropriate restriction enzymes. 3. We first combine the last two fragments by ligation. The procedure is as follows: (1)Add the respective digestion products, vector plasmid, buffer, ligase to ddwater (2)React at 16??C for 30 minutes (3)Inactivate the ligase by incubation it at 80??C for 20 minutes (4)Store the products at 4??C 4. The products of ligation are then transformed into competent cells. The procedure is as follows: (1)2??l plasmids(ligation products) are added to 33??l competent cells (2)Shake gently for one second, and cool it on ice (3)Incubate it in 42??C water bath for 45 seconds (4)Spread the liquid to plate which corresponding antibiotics have been added to (5)37??C overnight 5. The next day we do a colony PCR for the transformed cells and have the PCR products electrophoresis to make sure that the two fragments have been combined correctly. 6. Now we separate the plasmids(RBS+LuxR+RBS+LuxI+double ter sites) from E. Coli, and digest it with restriction enzyme. 7. The first fragment (Ptet) is then combined with the above product by ligation, and transformed into competent cells by the same we have done early. 8. Because the length of Ptet to the remain segment is relatively too short, we cannot confirm whether they have combined correctly by just do an electrophoresis of the colony PCR products. If the electrophoresis result seems like that they have combined, we then send the product to sequencing. false Chen-Hsi Tang component2247626 1 BBa_C0062 component2247623 1 BBa_B0034 component2247617 1 BBa_R0040 annotation2247626 1 BBa_C0062 range2247626 1 81 836 annotation2247617 1 BBa_R0040 range2247617 1 1 54 annotation2247623 1 BBa_B0034 range2247623 1 63 74 BBa_C0062 1 luxr luxR repressor/activator, (no LVA?) 2003-01-31T12:00:00Z 2015-08-31T04:07:23Z <em>V. fischeri</em> <genbank>AF170104</genbank> Released HQ 2013 In complex with HSL, LuxR binds to the Lux promoter, activating transcription from Pr <bb_part>BBa_R0062</bb_part>, and repressing transcription from Pl <bb_part>BBa_R0063</bb_part>. <p>The lux cassette of V. fischeri contains a left and a right promoter. The right promoter gives weak constitutive expression of downstream genes.This expression is up-regulated by the action of the Lux activator, LuxR complexed to HSL. Two molecules of LuxR protein form a complex with two molecules the signalling compound homoserine lactone (HSL). This complex binds to a palindromic site on the promoter, increasing the rate of transcription.</p> false true _1_ 0 24 7 In stock false <P> <P>2 silent point mutants were introduced in the coding sequence to remove internal XbaI and PstI sites. Mutation sites were chosen to replace codons commonly used in <em>E. coli</em> with codons used at a similar frequency. <P> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr annotation7039 1 BBa_C0062 range7039 1 1 756 annotation2213986 1 Help:Barcodes range2213986 1 757 781 annotation1766 1 luxR range1766 1 1 750 annotation1764 1 T range1764 1 174 174 annotation1762 1 prefix range1762 1 1 2 annotation1765 1 A range1765 1 492 492 BBa_R0040 1 p(tetR) TetR repressible promoter 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z Lutz, R., Bujard, H., <em>Nucleic Acids Research</em> (1997) 25, 1203-1210. Released HQ 2013 Sequence for pTet inverting regulator driven by the TetR protein.</P> false true _1_ 0 24 7 In stock false <P> <P>BBa_R0040 TetR-Regulated Promoter is based on a cI promoter. It has been modified to include two TetR binding sites and the BioBrick standard assembly head and tail restriction sites.<P> true June Rhee, Connie Tao, Ty Thomson, Louis Waldman annotation1986785 1 -35 range1986785 1 20 25 annotation1986787 1 -10 range1986787 1 43 48 annotation1986783 1 TetR 1 range1986783 1 1 19 annotation1986784 1 BBa_R0040 range1986784 1 1 54 annotation1986786 1 TetR 2 range1986786 1 26 44 BBa_B0034_sequence 1 aaagaggagaaa BBa_R0040_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac BBa_K332021_sequence 1 tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcactactagagaaagaggagaaatactagatgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac BBa_C0062_sequence 1 atgaaaaacataaatgccgacgacacatacagaataattaataaaattaaagcttgtagaagcaataatgatattaatcaatgcttatctgatatgactaaaatggtacattgtgaatattatttactcgcgatcatttatcctcattctatggttaaatctgatatttcaatcctagataattaccctaaaaaatggaggcaatattatgatgacgctaatttaataaaatatgatcctatagtagattattctaactccaatcattcaccaattaattggaatatatttgaaaacaatgctgtaaataaaaaatctccaaatgtaattaaagaagcgaaaacatcaggtcttatcactgggtttagtttccctattcatacggctaacaatggcttcggaatgcttagttttgcacattcagaaaaagacaactatatagatagtttatttttacatgcgtgtatgaacataccattaattgttccttctctagttgataattatcgaaaaataaatatagcaaataataaatcaaacaacgatttaaccaaaagagaaaaagaatgtttagcgtgggcatgcgaaggaaaaagctcttgggatatttcaaaaatattaggttgcagtgagcgtactgtcactttccatttaaccaatgcgcaaatgaaactcaatacaacaaaccgctgccaaagtatttctaaagcaattttaacaggagcaattgattgcccatactttaaaaattaataacactgatagtgctagtgtagatcac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z