BBa_K334000 1 BBa_K334000 Oxygen Dependent Degradation Domain 2010-07-20T11:00:00Z 2015-05-08T01:12:05Z HIF-1a Gene Part of the degradation domain taken from the HIF-1a protein in humans. Under normal oxygen conditions, prolyl hydroxylases target this domain for hydroxylation. The hydroxylated subunit makes the resultant protein a target for E3 ubiquin ligase when bound by the VHL gene product, leading to its proteasomal degradation. This can be used, when fused to a reporter protein, to indicate the activity of endogenous HIF-1a in real-time. false false _464_ 0 6891 9 Not in stock false Consulted literature assessing the activity of this domain under certain degrees of oxygen distress. false Sean Kearney BBa_K334000_sequence 1 atgaacccgtttagcacccaggataccgatctggatctggaaatgctggcgccgtatattccgatggatgatgattttcagctgcgtagctttgatcagctgagcccgctggaaagcagcagcgcgagcccggaaagcgcgagcccgcagagcaccgtgaccgtgtttcagtaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z