BBa_K337004 1 BBa_K337004 hsa-miR-122 Binding site pattern (2BS) 2010-10-20T11:00:00Z 2015-05-08T01:12:06Z The spacer sequences, present between the miRNA binding sites, should have the lowest compatibility to known miRNAs, to minimize unspecific sequence recognition. hsa-miR-122 binding site pattern, consisting of 2 perfect matching binding sites. The binding sites are seperated by sequences of 30 base pairs, which are innert in terms of miRNA binding. Additionally, half of the separation sequence is either in front or the end of the whole pattern, to be unconnected to standard restriction sites. false false _461_ 0 7259 9 It's complicated false http://mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0000421 false Adlung L,Al Sabah J,Bayer P,Berrens R,Cristiano E,Flocke L,Kleinsorg S,Kolodziejczyk A,Macias Torre A,Mathur A,Mayilo D,Neumann S,Niopek D,Pisa R,Schad J,Schuhmacher L,Uhlig T,Wu X,Grimm D,Eils R annotation2091213 1 Spacer 1st half range2091213 1 1 15 annotation2091216 1 Spacer 1st half range2091216 1 53 67 annotation2091214 1 Spacer 2nd half range2091214 1 38 52 annotation2091215 1 Spacer 2nd half range2091215 1 90 104 BBa_K337004_sequence 1 cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgccactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z