BBa_K337005 1 BBa_K337005 hsa-miR-122 Binding site pattern (2BS - additional 10bp Spacer) 2010-10-20T11:00:00Z 2015-05-08T01:12:06Z http://mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0000421 hsa-miR-122 binding site pattern, consisting of 2 perfect matching binding sites. The binding sites are seperated by a sequence of 40 base pairs, which are innert in terms of miRNA binding. Additionally, first 15bp and last 15bp of the separation sequence is either in front or the end of the whole pattern, to be unconnected to standard restriction sites. false false _461_ 0 7259 9 It's complicated false The spacer sequences, present between the miRNA binding sites, should have the lowest compatibility to known miRNAs, to minimize unspecific sequence recognition. false Adlung L,Al Sabah J,Bayer P,Berrens R,Cristiano E,Flocke L,Kleinsorg S,Kolodziejczyk A,Macias Torre A,Mathur A,Mayilo D,Neumann S,Niopek D,Schad J,Schuhmacher L,Uhlig T,Wu X,Grimm D,Eils R annotation2091226 1 Spacer 1st half range2091226 1 63 77 annotation2091227 1 Spacer 1st half range2091227 1 1 15 annotation2091225 1 Spacer 2nd half range2091225 1 100 114 annotation2091223 1 Spacer 2nd half range2091223 1 38 52 annotation2091224 1 addtional 10bp spacer range2091224 1 53 62 BBa_K337005_sequence 1 cactgaatccaactgcaaacaccattgtcacactccagcatacatggactgcgagaaatagccactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z