BBa_K337007 1 BBa_K337007 hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12 2010-10-20T11:00:00Z 2015-05-08T01:12:06Z http://mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0000421 1.8 false false _461_ 0 7259 9 It's complicated false The spacer sequences, present between the miRNA binding sites, should have the lowest compatibility to known miRNAs, to minimize unspecific sequence recognition. false Adlung L,Al Sabah J,Bayer P,Berrens R,Cristiano E,Flocke L,Kleinsorg S,Kolodziejczyk A,Macias Torre A,Mathur A,Mayilo D,Neumann S,Niopek D,Pisa R,Schad J,Schuhmacher L,Uhlig T,Wu X,Grimm D,Eils R annotation2091242 1 Spacer 1st half range2091242 1 53 67 annotation2091239 1 Spacer 1st half range2091239 1 1 15 annotation2091240 1 Spacer 2nd half range2091240 1 38 52 annotation2091241 1 Spacer 2nd half range2091241 1 90 104 BBa_K337007_sequence 1 cactgaatccaactgcaaacaccattgtaacactccagcatacatggactgccactgaatccaactgcaaacaccatttgaacactccagcatacatggactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z