BBa_K337008 1 BBa_K337008 hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12 2010-10-20T11:00:00Z 2015-05-08T01:12:06Z The spacer sequences, present between the miRNA binding sites, should have the lowest compatibility to known miRNAs, to minimize unspecific sequence recognition. 3.1 false false _461_ 0 7259 9 It's complicated false http://mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0000421 false Adlung L,Al Sabah J,Bayer P,Berrens R,Cristiano E,Flocke L,Kleinsorg S,Kolodziejczyk A,Macias Torre A,Mathur A,Mayilo D,Neumann S,Niopek D,Pisa R,Schad J,Schuhmacher L,Uhlig T,Wu X,Grimm D,Eils R annotation2091243 1 Spacer 2nd half range2091243 1 90 104 annotation2091246 1 Spacer 1st half range2091246 1 1 15 annotation2091245 1 Spacer 1st half range2091245 1 53 67 annotation2091244 1 Spacer 2nd half range2091244 1 38 52 BBa_K337008_sequence 1 cactgaatccaactgcaaacaccatatagacactccagcatacatggactgccactgaatccaactgcaaacaccatttttacactccagcatacatggactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z