BBa_K337010 1 BBa_K337010 hsa-miR-122 Binding site pattern (2BS) with randomised nt9-12 2010-10-20T11:00:00Z 2015-05-08T01:12:06Z http://mirbase.org/cgi-bin/mature.pl?mature_acc=MIMAT0000421 4.6 false false _461_ 0 7259 9 It's complicated false The spacer sequences, present between the miRNA binding sites, should have the lowest compatibility to known miRNAs, to minimize unspecific sequence recognition. false Adlung L,Al Sabah J,Bayer P,Berrens R,Cristiano E,Flocke L,Kleinsorg S,Kolodziejczyk A,Macias Torre A,Mathur A,Mayilo D,Neumann S,Niopek D,Pisa R,Schad J,Schuhmacher L,Uhlig T,Wu X,Grimm D,Eils R annotation2091261 1 Spacer 2nd half range2091261 1 100 114 annotation2091263 1 Spacer 1st half range2091263 1 63 77 annotation2091262 1 additional 10bp spacer range2091262 1 53 62 annotation2091260 1 Spacer 2nd half range2091260 1 38 52 annotation2091259 1 Spacer 1st half range2091259 1 1 15 BBa_K337010_sequence 1 cactgaatccaactgcaaacaccattgcgacactccagcatacatggactgcgagaaatagccactgaatccaactgcaaacaccattgtcacactccagcatacatggactgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z