BBa_K337052 1 BBa_K337052 synthetic binding site of shRNA miRhaat (perfect) KD:97% 2010-10-25T11:00:00Z 2015-05-08T01:12:06Z synthetic perfect binding site of shRNA miRhaat in the tuning construct leads to a knockdown percentage of 97% percent if introduced into the 3'UTR of the gene of interest (GOI) false false _461_ 0 7192 9 Not in stock true Designed to give a maximum knockdowm if introduced into the 3'UTR of the GOI. false Rebecca Berrens annotation2104049 1 seed haat range2104049 1 12 19 BBa_K337052_sequence 1 gaagcgtttaggcatgtttaacatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z