BBa_K337054 1 BBa_K337054 synthetic binding site of shRNA miRhaat (imperfect) KD:28% 2010-10-25T11:00:00Z 2015-05-08T01:12:06Z synthetic imperfect binding site of shRNA miRhaat in the tuning construct leads to a knockdown percentage of 29% percent if introduced into the 3'UTR of the gene of interest (GOI) false false _461_ 0 7192 9 Not in stock false Designed to lead to a knockdown percentage of 30% if introduced in the 3'UTR of your GOI. The synthetic binding side has to be co-transfected with the corresponding synthetic miRNA. false Rebecca Berrens annotation2104104 1 seed haat range2104104 1 12 19 BBa_K337054_sequence 1 gttccgtttaggcatgtttaacatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z