BBa_K337056 1 BBa_K337056 synthetic binding site of miR 122 (imperfect) KD: 64% 2010-10-25T11:00:00Z 2015-05-08T01:12:06Z synthetic imperfect binding site of miR122 in the tuning construct leads to a knockdown percentage of 64% percent if introduced into the 3'UTR of the gene of interest (GOI). part can be either co-transfected with a synthetic miRNA or transfected into liver cell lines (i.e. Huh7). false false _461_ 0 7192 9 Not in stock false designed to lead to 60% KD if introduced into the 3'UTR of your GOI and transfected into liver cell lines or co-transfected with miR122 false Rebecca Berrens annotation2104229 1 misc range2104229 1 18 25 BBa_K337056_sequence 1 actaaggctgctccatcaacactcca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z