BBa_K338003 1 BBa_K338003 PHA Synthase Composite, Part 1/2 2010-10-25T11:00:00Z 2015-05-08T01:12:07Z Registry of Standard Biological Parts This is half of a planned part which would contain all three PHA synthase genes required to produce [http://en.wikipedia.org/wiki/Polyhydroxybutyrate polyhydroxybutyrate] (PHB) in cells: ''phaA'', ''phaB1'', ''phaC1''. This half contains only ''phaA'': <partinfo>BBa_K156012</partinfo>. It was designed to be ligated upstream of part [[Team:Caltech/BBa_K338004|BBa_K338004]]. false false _454_ 0 6013 9 It's complicated false When ligated upstream of [[Team:Caltech/BBa_K338004|BBa_K338004]], the completed construct was designed to express all three PHA synthase genes required to make PHB oligomers from soybean oil. The three genes would be transcribed polycistronically on a single mRNA transcript under the IPTG-inducible control of the <partinfo>BBa_K215000</partinfo> promoter. Naturally, each gene is preceded by a standard RBS (<partinfo>B0034</partinfo>) and the transcript finishes with a strong terminator (<partinfo>B0015</partinfo>), for a total size of about 3500bp. Note that these three genes should only cause the production of PHB ''oligomers'' in cells, not hardened plastic. A crosslinking agent is required to link the oligomers and form the final plastic product. Over-expression of the ''phaC1'' gene could cause some crosslinking, but this has not been experimentally verified. false Caltech iGEM 2010 component2101448 1 BBa_B0034 component2101443 1 BBa_K215000 component2101445 1 BBa_B0034 component2101446 1 BBa_K156012 annotation2101448 1 BBa_B0034 range2101448 1 1292 1303 annotation2101446 1 BBa_K156012 range2101446 1 102 1283 annotation2101445 1 BBa_B0034 range2101445 1 84 95 annotation2101443 1 BBa_K215000 range2101443 1 1 75 BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation2001 1 lac O1 range2001 1 26 42 annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2000 1 -35 range2000 1 20 25 BBa_K156012 1 Bioplastic phaA (acetyl-CoA acetyltransferase) 2008-10-28T12:00:00Z 2015-05-08T01:10:54Z This coding region is native to ''Ralstonia eutropha'' H16. The original sequence was obtained from GenBank (VERSION NC_008313.1, GI:113866031). This part codes for an enzyme that catalyzes the synthesis of acetoacetyl-coenzyme A from two molecules of acetyl-coenzyme A. The enzyme can also act as a thiolase, catalyzing the reverse reaction and generating two-carbon units from the four-carbon product of fatty acid oxidation. false false _246_ 0 1475 9 It's complicated false This part was codon-optimized for expression in E. coli. The following restriction enzyme sites were also removed: EcoRI, NotI, XbaI, SpeI, PstI, NheI, AvrII, ApoI, MfeI, NsiI, SbfI. false George McArthur IV BBa_K215000 1 BBa_K215000 R0011+B0034, strong IPTG-inducible promoter with strong RBS. 2009-09-29T11:00:00Z 2015-05-08T01:11:29Z existing registry parts This part contains the strong, IPTG-inducible promoter R0011, combined with the strong RBS B0034. This part can be used as a strong protein expression system when combined with a protein coding sequence. false false _320_ 0 2811 9 It's complicated true This part should offer greater levels of expression when compared to similar parts using the natural lac promoter (R0010). false Chris Eiben component2027435 1 BBa_R0011 component2027441 1 BBa_B0034 annotation2027435 1 BBa_R0011 range2027435 1 1 54 annotation2027441 1 BBa_B0034 range2027441 1 64 75 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K156012_sequence 1 atgactgatgttgttattgtatctgccgctcgtactgctgttggtaaatttggtggtagcctggctaaaatcccggcacctgagctgggcgctgtagttatcaaagctgcgctggaacgtgcgggcgttaaaccggagcaagtgtccgaagtcatcatgggccaagtactgacggcgggcagcggccagaacccggctcgccaggcggccattaaagcaggtctgccggccatggtgccggcaatgaccattaacaaagtttgcggttctggtctgaaagctgttatgctggcagctaatgcaatcatggcaggtgacgcagagattgttgtcgctggtggtcaagaaaacatgagcgctgctccgcatgttctgccaggctcccgtgacggtttccgtatgggtgatgcaaaactggtggacactatgatcgtcgacggcctgtgggatgtgtataaccagtatcacatgggtattaccgcagagaacgttgcgaaagaatatggcattacgcgtgaagcgcaggacgaatttgcagtgggttctcagaacaaagccgaagcggctcagaaagctggtaagttcgacgaagaaatcgtaccggttctgattccgcagcgcaagggtgatccggtagcattcaaaaccgatgagttcgtacgccagggcgctactctggattccatgtctggcctgaaaccggcattcgacaaagcaggtaccgtgacggctgcgaacgcgagcggcctgaacgatggcgcggctgcggttgtggtcatgagcgcggcgaaagctaaagaactgggcctgacgccgctggcgactatcaaatcttacgcgaacgcaggtgtggatccgaaggtgatgggtatgggtcctgtgccagctagcaagcgcgctctgtcccgcgctgaatggactccgcaggatctggatctgatggagattaacgaagctttcgctgcgcaggcgctggcggtacatcagcagatgggttgggacacttctaaagtcaatgtaaacggcggtgccattgcgatcggccacccgatcggcgcttccggttgccgcatcctggtaaccctgctgcacgaaatgaaacgtcgtgacgctaagaaaggtctggcctctctgtgcattggtggcggcatgggtgttgccctggccgttgaacgtaaatga BBa_K215000_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaa BBa_K338003_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaatactagagaaagaggagaaatactagatgactgatgttgttattgtatctgccgctcgtactgctgttggtaaatttggtggtagcctggctaaaatcccggcacctgagctgggcgctgtagttatcaaagctgcgctggaacgtgcgggcgttaaaccggagcaagtgtccgaagtcatcatgggccaagtactgacggcgggcagcggccagaacccggctcgccaggcggccattaaagcaggtctgccggccatggtgccggcaatgaccattaacaaagtttgcggttctggtctgaaagctgttatgctggcagctaatgcaatcatggcaggtgacgcagagattgttgtcgctggtggtcaagaaaacatgagcgctgctccgcatgttctgccaggctcccgtgacggtttccgtatgggtgatgcaaaactggtggacactatgatcgtcgacggcctgtgggatgtgtataaccagtatcacatgggtattaccgcagagaacgttgcgaaagaatatggcattacgcgtgaagcgcaggacgaatttgcagtgggttctcagaacaaagccgaagcggctcagaaagctggtaagttcgacgaagaaatcgtaccggttctgattccgcagcgcaagggtgatccggtagcattcaaaaccgatgagttcgtacgccagggcgctactctggattccatgtctggcctgaaaccggcattcgacaaagcaggtaccgtgacggctgcgaacgcgagcggcctgaacgatggcgcggctgcggttgtggtcatgagcgcggcgaaagctaaagaactgggcctgacgccgctggcgactatcaaatcttacgcgaacgcaggtgtggatccgaaggtgatgggtatgggtcctgtgccagctagcaagcgcgctctgtcccgcgctgaatggactccgcaggatctggatctgatggagattaacgaagctttcgctgcgcaggcgctggcggtacatcagcagatgggttgggacacttctaaagtcaatgtaaacggcggtgccattgcgatcggccacccgatcggcgcttccggttgccgcatcctggtaaccctgctgcacgaaatgaaacgtcgtgacgctaagaaaggtctggcctctctgtgcattggtggcggcatgggtgttgccctggccgttgaacgtaaatgatactagagaaagaggagaaa BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z