BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K338001 1 HSP Heat Shock Promoter (HSP) 2010-10-23T11:00:00Z 2015-05-08T01:12:07Z Modified BBa_K112400 This is a modified K112400 heat shock promoter in BBa standard. false false _454_ 0 6189 9 It's complicated true None false 2010 Caltech iGEM Team BBa_K338081 1 BBa_K338081 Heat-Shock Activated Generator 2010-10-26T11:00:00Z 2015-05-08T01:12:07Z The Registry of Standard Biological Parts Intermediate designed to accelerate cloning of the HSP promoter (<partinfo>BBa_K338001</partinfo>) by adding an RBS downstream. false false _454_ 0 6013 9 It's complicated false Designed to be ligated upstream of the desired heat-shock product. Keep in mind that the promoter is somewhat leaky and that cultures should be grown at 30&deg;C. false Lucas Hartsough component2105680 1 BBa_B0034 component2105678 1 BBa_K338001 annotation2105680 1 BBa_B0034 range2105680 1 107 118 annotation2105678 1 BBa_K338001 range2105678 1 1 98 BBa_K338081_sequence 1 ccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcgtactagagaaagaggagaaa BBa_B0034_sequence 1 aaagaggagaaa BBa_K338001_sequence 1 ccgaggtccttgttgcgaagattgatgacaatgtgagtgcttcccttgaaaccctgaaactgatccccataataagcgaagttagcgagatgaatgcg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z